GithubHelp home page GithubHelp logo

Comments (2)

fataltes avatar fataltes commented on July 17, 2024

Hi @apcamargo ,

Thank you for your post. However, I am not sure if I understand the request clearly.
Would you mind explaining a little bit more?

from pufferfish.

apcamargo avatar apcamargo commented on July 17, 2024

Sure, @fataltes!

Here's Puffaligner's (using --bestStrata) samtools flagstat output:

214688504 + 0 in total (QC-passed reads + QC-failed reads)
50488220 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
125913389 + 0 mapped (58.65% : N/A)
164200284 + 0 paired in sequencing
82100142 + 0 read1
82100142 + 0 read2
83360444 + 0 properly paired (50.77% : N/A)
83360444 + 0 with itself and mate mapped
6101721 + 0 singletons (3.72% : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)

Here's Bowtie2's (using -k 15):

241492571 + 0 in total (QC-passed reads + QC-failed reads)
77292287 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
159016623 + 0 mapped (65.85% : N/A)
164200284 + 0 paired in sequencing
82100142 + 0 read1
82100142 + 0 read2
74243714 + 0 properly paired (45.22% : N/A)
77436030 + 0 with itself and mate mapped
4288306 + 0 singletons (2.61% : N/A)
2489036 + 0 with mate mapped to a different chr
2027014 + 0 with mate mapped to a different chr (mapQ>=5)

Puffaligner's with mate mapped to a different chr is 0, meaning that there are no pairs with reads that mapped to different references.

Essentially, I'm interest in alignments where the 7th field is not =, for example:

HISEQ13:355:CBN0FANXX:7:1101:17319:1971	97	k147_2000503	17	38	150M	k147_584177	66	0	CGGCGGACTAAGGCTCTATAATTTCAATTTTTCACCAGACTAAGTAATCCATGAAGAAACTCATTGCAGCACTGGCTTCCAGTGTTCTGGTGATGTCCGCCGCCGTCGCCCAGACGCTGCCGGCGCCGACCATCGCCGCCAAATCGTGGC	=ABBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGFGG>GEGGGGGGDGFGGCGDGDGGGGG<DGGGGGGGBGGGGGGGGGGGGGGGGGGGGGGGGGG@	AS:i:0	XN:i:0	XM:i:0	XO:i:0	XG:i:0	NM:i:0	MD:Z:150	YT:Z:UP

from pufferfish.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.