Segfault in latest unit test of multiple matches about gramtools

[iqbal-lab]

Here is the test

`
TEST(BackwardSearchTest, Multiple_matches_over_multiple_sites){

//prg=acgacacat5gatag6tagga6gctcg6gctct5gctcgtgataatgactagatagatag7cga8cgc8tga8tgc7taggcaacatctacga                                                                       
test_file2="../test_cases/multiple_matches_multiple_sites.txt";
//read aligns over allele 1 of site 5, the nonvariableregion and allele 3 of site 7                                                                                       
query="tgata";

`
After running the backward search, this is what sites looks like

`
(gdb) p sites
$1 = std::list = {[0] = std::vector of length 0, capacity 0, [1] = std::vector of length 1, capacity 100 = {{first = 7, second = std::vector of length 0, capacity 0}}, [2] = std::vector of length 1, capacity 100 = {{first = 5, second = std::vector of length 1, capacity 1 = {1}}}}

`

So we correctly see 7 first, and fail to spot the overlap with allele 3, because it does not cross the 5 - so it's correct/expected behavious to have this {{first = 7, second = std::vector of length 0, capacity 0}}.

This is also correct, and correctly after the 7
{{first = 5, second = std::vector of length 1, capacity 1 = {1}}

I just wasn't expecting this at the front:
[0] = std::vector of length 0, capacity 0,

[iqbal-lab]

Need to read the code - in fact if I spent the time reading the code not bug-raising - er - I might have to go away from the computer and forget what i was doing

[iqbal-lab]

This is idiocy on my part. Fixing.

[iqbal-lab]

Fixed. I forgot there was a match in the nonvariable region, and anyway my test code was wrong. test passes now.

[iqbal-lab]

Wow, github clever enough to auto close this bug on the basis of the comment on that commit!!!