Make it possible for RNAStructure to get initialized with a file about rna-tools

[mmagnus]

dear @valentin994 it's great that you found the code useful. Let me know if you need any help.

And yeah, let me see what you have so we can improve the package here.

[valentin994]

In the end, I ended up creating a parser, it might be useful here too, or biopython so let me know what you think.

So the problem I stumbled upon when using RnaStructure().get_sequence is that I wouldn't always get the sequence expected (I can't really explain in biological terms as I'm a developer but I'll run through examples that might give you insight onto this).

For example these pdb files "2l8h", "6b14", "6las" the output from get_sequence() would be:

• GGCAGAUCUGAGCCUGGGAGCUCUCUGCCRh
• GACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUCghhhhhhhhhhhhhhhhhhhhhhhhh
• GUUGAUAUGGAUUUACUCCGAGGAGACGAACUACCACGAACAGGGGAAACUCUACCCGUGGCGUCUCCGUUUGACGAGUAAGUCCUAAGUCAACAggggooooghhhhhhhh
• GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUCmhhhhhhhhh GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUChh RPNHTIYINNLNEKIKKDELKKSLHAIFSRFGQILDILVKRSLKeRGQAFVIFKEVSSATNALRSeQGFPFYDKPeRIQYAKTDSDIIAKehh TRPNHTIYINNLNEKIKKDELKKSLHAIFSRFGQILDILVKRSLKeRGQAFVIFKEVSSATNALRSeQGFPFYDKPeRIQYAKTDSDIIAKeAhhhhh RPNHTIYINNLNEKIKKDELKKSLHAIFSRFGQILDILVKRSLKeRGQAFVIFKEVSSATNALRSeQGFPFYDKPeRIQYAKTDSDIhhhh

While I would expect:

• GGCAGAUCUGAGCCUGGGAGCUCUCUGCC
• GACGCGACCGAAAUGGUGAAGGACGGGUCCAGUGCGAAACACGCACUGUUGAGUAGAGUGUGAGCUCCGUAACUGGUCGCGUC
• GUUGAUAUGGAUUUACUCCGAGGAGACGAACUACCACGAACAGGGGAAACUCUACCCGUGGCGUCUCCGUUUGACGAGUAAGUCCUAAGUCAACA
• GGCAUUGUGCCUCGCAUUGCACUCCGCGGGGCGAUAAGUCCUGAAAAGGGAUGUC

The expected sequences is what you can get if you get the fasta version of the files mentioned and you pull out the sequence with SeqIo parser. Now I'm not sure if the sequences I get from this package are the expected behaviour, or if there is any need to be able to parse them out like I do now. If you find it useful I can create a PR or show you more in depth how it would look. I hope that I managed to explain it well enough 😓

[valentin994]

Oh, I sidetracked from the original question. But yeah initializing with bytes can also be done.