• C++11 compatible compiler (tested on Apple LLVM version 6.1.0 and GCC version 4.8.1)
• Vienna RNA package (>= 2.3)

export PKG_CONFIG_PATH=/path/to/vienna-rna/lib/pkgconfig:${PKG_CONFIG_PATH}
mkdir build && cd build
cmake -DCMAKE_BUILD_TYPE=Release ..
make

MXfold can take a FASTA formatted RNA sequence as input, then predicts its secondary structure.

% mxfold test.fa
> DS4440
GGAUGGAUGUCUGAGCGGUUGAAAGAGUCGGUCUUGAAAACCGAAGUAUUGAUAGGAAUACCGGGGGUUCGAAUCCCUCUCCAUCCG
>structure
(((((((........(((((..(((.......)))...)))))..(((((......))))).(((((.......)))))))))))).

A web server is working at http://www.dna.bio.keio.ac.jp/mxfold/.

Copyright (c) 2017-2019 Kengo Sato, Manato Akiyama
Released under the MIT license
http://opensource.org/licenses/mit-license.php

MXfold is based on the source code of CONTRAfold.

• Akiyama, M., Sato, K., Sakakibara, Y.: A max-margin training of RNA secondary structure prediction integrated with the thermodynamic model, J. Bioinform. Comput. Biol., 16(6), 1840025 (2018), DOI: 10.1142/S0219720018400255.