adapter trimming with respect to quality about fastp

[sfchen]

Thanks Jasper,

This problem is caused by that the overlap region of the second pair has too many mismatches (4 mismatches), so fastp doesn't treat them as overlapped.

I extracted the overlapped region, and computed the reverse complement of read1 to make a alignment (mismatches are shown in lower case):

CTCTTTGAAgCAATTGTGAATGGGAGTTCATTCATGGTTTGGCTCTCTGTTTGTCTGTTATTGGTGTAaAAGAATGCTTGTGATTTTTGTACATTGATTTTGTgTCCTgAGACT
CTCTTTGAAACAATTGTGAATGGGAGTTCATTCATGGTTTGGCTCTCTGTTTGTCTGTTATTGGTGTATAAGAATGCTTGTGATTTTTGTACATTGATTTTGTATCCTCAGACT

I will make a revision to increase the tolerance of such low-quality mismatches to address this problem. I will update this issue when it's implemented.

I'm glad that fastp can give help to your work, and I will continue to improve it. Thanks for your good test case.

Thanks
Shifu

[sfchen]

With new version, you can specify adapter sequence to address this issue.