Query fails on online DB about pr2database

[vaulot]

Hi Nastassia

Thank you for the query. The logs are for internal use but I can check them on the server.

Can you send me the sequence you are trying to BLAST in the exact form that you are using for the query.

Thanks in advance. Cheers.

[nvpatin]

Thanks for the quick response. The nucleotide sequence I am running is:

ATTAAGTACTTCCTTCATGAGTTTATCTCCTTCTAGCACTGCTTATATTATATTTGGATTATTAATGGCTGGAATATCCTCCTGTGTCACGTCTCTTAACTTTTGGGTTACAATATTAAATATGAGATGTTACAGTCTCACATTAAAAACTATGGTATTATTCTCTTGGAGTCTTTTGATTACTGGAGCTATGCTTTTATTAACATTGCCAGTATTAACAGGAGCTCTTCTTATGATATTGTCTGATCTTCATTGTAATACTCTTTTATTTGATCCAGTTTTTCTTGGAGACCCTGTACTCTATCAACATT

I enter exactly as above, with no header.

[vaulot]

Hi Nastassia

When I BLAST this sequence against GenBank, I do not find any hit. This is the same what is happening with PR2 (since PR2 is just a subset of GenBank sequences). Still there is bug and it should return that there is no significant hit.... I will fix for the next release.

[nvpatin]

That's true for megablast, but when I use blastn I get hits with ~83% identity. I guess I was hoping PR2 would have additional or more confident annotations but if it has the exact same sequences as GenBank then this makes sense. Thanks for clarifying!

[vaulot]

Hi Nastassia

Just to wrap up... PR2 is ONLY 18S rRNA sequences and your sequence comes from the cox1 mitochondrial gene which is not covered by PR2.

Best.