no alignment score value found in reads about phaser

[secastel]

You can fix this error by including "--as_q_cutoff 0" as an argument when running phaser.

Note, phaser performs much better when an alignment score cutoff is used. Note that this is distinct from a mapping score or MAPQ. If possible I would suggest using an aligner that outputs an alignment score, which is included as an "AS" tag, such as STAR.

[molecularsensei]

Thanks for getting back. I used bwa mem for alignment and the AS tag is present in the bam file.

SRR6251266.167696392 97 chr8 10051 60 42M = 149413 139404 ACAAATGTCCTTTACATGTTTTCTGTTACAGTAGTAACAATA AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE NM:i:0 MD:Z:42 MC:Z:42M AS:i:42 XS:i:29

Is this not the AS tag I should look for?

I also tried using the --as_q_cutoff 0 argument but get an error:
....
minimum mapq: 60
mapping reads to variants...
completed chromosome chr8...
processing mapped reads...
retrieved 0 reads
#3. Identifying connected variants...
calculating sequencing noise level...
FATAL ERROR: No reads could be matched to variants. Please double check your settings and input files. Common reasons for this occurring include: 1) MAPQ or BASEQ set too conservatively 2) BAM and VCF have different chromosome names (IE 'chr1' vs '1')
....

I will try mapping with STAR and see if things change.

[secastel]

You're right that the AS tag is present in the BAM, so I'm confused as to the why the AS score wasn't getting picked up. As for the fact that 0 reads are getting processed, can you confirm that your VCF naming matches the BAM naming, e.g. "chr1" is listed in the first column of the VCF. If the VCF simply has "1" you can run phaser with the option "--chr_prefix chr" which should fix that.

As for the AS problem, is there any way you could provide a sample BAM so that I could debug the issue you are having? Were you able to try with STAR aligned reads?

[bmansfeld]

For other people who might still be getting this using GATK for variant calling.
The GATK4 RNASeq pipeline recommends a CIGAR split step and I think that is causing some issues with the bam files used in Phaser.
If I used the STAR aligned, deduplicated but not CIGAR N split bam file with my GATK4 derived vcf I was able to use Phaser without getting this error.
Ben

[teng-gao]

Getting this error as well, pretty mysteriously for only 1 out of my BAMs. Edit: actually, turns out my error is because the BAM is not paired end and I set paired_end = 1