Urinx/2dRNA-Fold

Learning RNA Folding Path based on Reinforcement Learning and Monte Carlo Tree Search

★ 3Forks 1PythonGitHub ↗Compare

README

2dRNA-Fold: Learning RNA Folding Path based on Reinforcement Learning and Monte Carlo Tree Search

Contents

Introduction

We propose an RNA secondary structure folding path learning algorithm based on deep reinforcement learning combined with Monte Carlo Tree Search (MCTS), called 2dRNA-Fold. 2dRNA-Fold selects residue pairing step by step according to a given RNA sequence until the final secondary structure is formed. Then, we can find a folding path with the largest probability that is considered as the folding path of the RNA. The following diagram illustrates the entire pipeline.

Figure 1: The diagram of 2dRNA-Fold predicts the secondary structure folding path of a single RNA molecule.

Results

Here one small RNA with a length of 30 nucleotides is selected and used 2dRNA-Fold to learn and visualize their folding paths (shown as the figure 2). Its sequence secondary structure is:

AAGCGGAACGAAACGUUGCUUUUGCGCCCU
.((.((.(((...)))(((....)))))))

Figure 2: Learned folding path of an RNA. The top is the folding path tree, and the bottom is the visualized folding path.

System Requirments

Software Requirments:

Usage

For secondary structure folding path of single sequence:

python main.py --model model/PDB_00010 --fold data/PDB_00010.bp

For a single RNA molecule, here we provide some examples including trained models and data, see the model and data folders. This command is used to predict the secondary structure of a single RNA molecule and visualize the predicted folding path. The intermediate output process is shown in Figure 3.

Figure 3: secondary structure folding path prediction for single sequence.

For secondary structure prediction of single sequence:

python main.py --model model/bpRNA_21650 --pred GGAGGCUCUGGCAGCUUUC

Datasets

The following datasets were used for multi-RNA molecules folding path learning:

Contributors

Urinx

Issues