GithubHelp home page GithubHelp logo

bitmanipulation-1's Introduction

BitManipulation-1

Problem1

Divide Two Integers(https://leetcode.com/problems/divide-two-integers/)

Given two integers dividend and divisor, divide two integers without using multiplication, division and mod operator.

Return the quotient after dividing dividend by divisor.

The integer division should truncate toward zero.

Example 1:

Input: dividend = 10, divisor = 3 Output: 3 Example 2:

Input: dividend = 7, divisor = -3 Output: -2 Note:

Both dividend and divisor will be 32-bit signed integers. The divisor will never be 0. Assume we are dealing with an environment which could only store integers within the 32-bit signed integer range: [−231, 231 − 1]. For the purpose of this problem, assume that your function returns 231 − 1 when the division result overflows.

Problem 2

Single number (https://leetcode.com/problems/single-number/)

Given a non-empty array of integers, every element appears twiceexcept for one. Find that single one.

Note:

Your algorithm should have a linear runtime complexity. Could you implement it without using extra memory?

Example 1:

Input: [2,2,1]

Problem 3

Pair of Single numbers

An array of numbers is gven to you and there exists exactly two elements which appear once and other elements appear twice you need to give the two elements that appear only once. The order in which your result appears is not important and make sure that your algorithm runs in linear time complexity and constant space complexity.

Example:

Input: [1,2,1,3,3,4,4,8,2,5] Output: [8,5]

Output: 1

Example 2:

Input: [4,1,2,1,2]

Output: 4

Problem3

Repeated DNA Sequences (https://leetcode.com/problems/repeated-dna-sequences/)

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]

bitmanipulation-1's People

Contributors

super30admin avatar a-b-n avatar

Watchers

James Cloos avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.