GithubHelp home page GithubHelp logo

select_top_genes's Introduction

select_top_genes

This is the Git repository for select_top_genes, a small utility that selects the top genes from an assembled transcriptome according to their coverage. This utility is used in a couple of my projects, so it has been separated into its own repository.

Requirements

This utility has been tested with the following dependencies:

  • Perl 5.36.0
  • Bash 5.2.15
  • GNU Parallel 20221122
  • Perl libraries
    • Bio::SeqIO

Other configurations likely work as well but are untested.

Basic usage

This software is designed to work on transcriptomes assembled from RNA-seq data. Each sequence in the assembled transcriptome (i.e., each transcript) belongs to a single gene, but each gene may have multiple transcripts, called "isoforms" of that gene. Additionally, every transcript is assumed to be associated with a "coverage" value that quantifies how much of the input RNA-seq data contributed to the assembly of the transcript. This software assumes that the coverage and gene ID are present in the FASTA sequence header for each transcript.

The main script is select_top_sets.pl. (In the name of that script, "sets" refers to "isotig sets," which we understand as synonymous with "genes" in this context.) select_top_sets_all.sh facilitates selecting the top genes for multiple transcriptomes in parallel, and count_genes.pl is a related utility that counts the number of genes in a transcriptome.

The select_top_sets.pl selects the top $n$ genes of an assembly according to their ($k$-mer) coverage. We define (somewhat arbitrarily) the coverage of a gene to be the maximum coverage among the gene's isoforms.

For a transcriptome assembled with a recent version of SPAdes, it is enough to provide select_top_sets.pl with a path to the assembly and the number of top genes that should be selected.

perl select_top_sets.pl --transcripts=TRANSCRIPTS --top=TOP

In the above example, TRANSCRIPTS should be replaced with a path to the transcripts FASTA file produced by SPAdes, and TOP should be replaced with the number of top genes to select.

select_top_sets.pl writes to standard output, so the output will need to redirected if you want to write to a file.

select_top_sets.pl assumes that sequence header lines look like the one below.

>NODE_66210_length_748_cov_89.957082_g13242_i5
CAAAAACTGTTACTGCTGTCTGGTAGGGATAGAGAACCATGTCACATATCCCACATAACT
ATTACAGTCTCAATCTTCTGTTACACGAGCAGGCAGAAGTTTACATGGTTCCTGGAGACA

This is the default format for sequence headers in SPAdes 3.15.5. In the above line, 89.957082 is the transcript's ($k$-mer) coverage. 13242 is the gene ID, and 5 is the isoform ID. We can parse this sequence header using a regular expression like ^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+), which is the default regex for select_top_sets.pl.

If the sequence header lines are different from those produced by SPAdes 3.15.5, you may need to specify a different pattern for parsing the FASTA sequence headers using the --pattern option. For select_top_sets.pl, the pattern must have at least two capture groups. The first group captures the coverage, a floating-point number, and the second group captures the gene ID.

For example, if the sequence header lines look like >cov15.5gene1, then the regular expression cov([0-9]+(?:\.[0-9]+))gene([0-9]+) would be appropriate.

Command-line usage for included scripts

count_genes.pl

As its name suggests, this utility counts the number of genes in a FASTA file containing an assembled transcriptome. If all genes have exactly one isoform, the count of genes is simply the number of sequences in the file, but some assemblers (e.g., SPAdes) may produce multiple "isoforms" per gene, making counting the number of genes slightly more difficult.

Like select_top_sets.pl, this script accepts a path to a FASTA file containing the transcripts and optionally accepts a Perl regular expression for parsing sequence headers. Requirements for the regular expression are slightly different from those of select_top_sets.plβ€”for count_genes.pl, at least two capture groups are still needed, but only the second capture group, assumed to be the gene ID, is used.

Unlike [select_top_sets.pl], count_genes.pl can read its input transcriptome from standard input because only one pass through the file is needed to count the number of genes.

Options

Option name Description Default Required
--help Display a help message and quit. No
--pattern Perl regular expression for parsing gene IDs from FASTA sequence headers. ^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+) No
--transcripts Path to assembed transcriptome FASTA file for which to count genes. No
pattern (count_genes.pl)

The pattern option should be a Perl regular expression for parsing the gene ID from FASTA sequence header lines in the provided assembled transcriptome.

Two capture groups are needed, but only the second capture group is used. The second capture group is interpreted as the gene ID. The first capture group may capture anything, including any empty string, but the default value for this option uses the first group to capture coverage. (This is convenient since it allows count_genes.pl and select_top_sets.pl to use the same regex.)

select_top_sets_all.sh

This script selects the top $n$ genes from multiple input transcriptomes in parallel. The script uses select_top_sets.pl and GNU Parallel, and like the former script, it accepts a regular expression for extracting a transcript's coverage and gene ID from its FASTA sequence header.

Instead of accepting multiple transcript FASTA files, this script accepts multiple directory names. It is assumed that the transcript FASTA files to be processed all have the same filename but are located in different directories. (This is a reasonable assumption for transcriptomes assembled using SPAdes and makes writing a command slightly easier. This design also makes the program less flexible, and it is likely the program will be changed in the future to a list of paths to transcript files instead.) Since SPAdes names the assembly transcripts.fasta, this is the default filename that select_top_sets_all.sh expects.

Since select_top_sets_all.sh operates on multiple inputs, it does not use standard output for writing the top genes. Instead, the script requires that an output directory be specified as an option to the program. An input file located at path/to/data1/transcripts.fasta will be output to a file named data1_top.fasta in the output directory.

Positional arguments

Argument name Description
DIR ... Each argument is a directory containing a transcripts FASTA file (named transcripts.fasta, by default).

Options

Short name Long name Description Default Required
-h --help Print a help message and exit. No
-j --jobs Number of parallel jobs to run. threads - 1 No
-o --out-dir Output directory in which to store top genes for each input. $PWD No
-p --pattern Perl regular expression for extracting gene IDs from transcript FASTA headers. ^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+) No
-n --top-n Number of top genes to select by coverage for each input transcripts file. 10000 No
-t --transcripts Filename of transcripts file found in each directory. No

select_top_sets.pl

This is the "main" script in this repository. The script selects the top genes by ($k$-mer) coverage in the provided transcripts FASTA file and writes them to the standard output.

select_top_sets.pl takes the coverage of a gene to be the maximum coverage among the gene's isoforms. For example, suppose gene 10 has two isoforms. If gene 10 isoform 0 has coverage 10.0, and gene 10 isoform 1 has coverage 10.5, then the coverage of gene 10 is 10.5.

The script assumes that the FASTA sequence header for each transcript indicates both the transcript's coverage and the transcript's gene ID. (It also currently assumes that these two pieces of information are provided in that order, but this may be fixed later.) select_top_sets.pl accepts a --pattern option that specifies a regular expression for parsing the FASTA sequence headers. By default, the regular expression ^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+) is used.

Options

Option name Description Default Required
--help Display a help message and quit. No
--pattern Perl regular expression for parsing coverages and gene IDs from FASTA sequence headers. ^.*cov_([0-9]+(?:\.[0-9]+))_g([0-9]+)_i([0-9]+) No
--transcripts Path to assembed transcriptome FASTA file for which to select top genes. Yes
--top Number of top genes to select. Yes
pattern (select_top_sets.pl)

The pattern option should be a Perl regular expression that can be used to extract the coverage and gene ID from a FASTA sequence header in the input transcriptome file.

The pattern must have at least two capture groups. The first capture group represents the coverage, which is assumed to be a floating-point number. The second capture group represents the gene ID, which may be any string.

Any pattern that works with this script should be compatible with count_genes.pl as well, but count_genes.pl has relaxed requirements for the pattern.

select_top_genes's People

Contributors

actapia avatar

Watchers

 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    πŸ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. πŸ“ŠπŸ“ˆπŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❀️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.