Comments (7)
This looks strange - I'm not entirely sure of the issue. Pinging @jts to see if he has any insights?
Is the command you are using to run nanopolish outside of the pipeline equivalent to the call within the pipeline?
One thing to change is to use fast5/barcode
as the input to --fast5-directory
, but this is unlikely to be the problem here.
from artic-ncov2019.
My best guess is that there is something about the sequencing_summary.txt
file that nanopolish doesn't like. I suggest running the nanopolish index command outside of the artic
wrappers to see what it prints to stderr, which might help diagnose what has gone wrong.
from artic-ncov2019.
Thanks folks,
Overnight last night I was able to run a different set of data smoothly and quickly. There must be something fishy with this one flowcell of data. I tried running just one fastq file with this command:
nanopolish index -d ../fast5/ -s ../sequencing_summary.txt -v ../plex_FAP90847_ACCACTGCCATGTATCAAAGTACG_pass_concat.fastq
[readdb] indexing ../fast5/
but I don't get any more output after that. I suspect there is some mismatch between the fastq/fast5/sequencing summary files I am using. I think I can dig in from here. Sorry for the trouble.
from artic-ncov2019.
Hi folks,
It looks like our system is doing something possibly unique.
We are loading a minION flowcell, but extracting the fastq files and sequencing summary at a timepoint in the middle of a run. At this time guppy has finished basecalling available fast5 files, but will be restarted once new fast5 files are available.
The run continues and fast5 files are generated until someone decides to shut down the sequencing run.
When I get around to starting my analysis I have the following inputs:
-fastq file from the intermediate timepoint
-sequencing summary file from the intermediate timepoint
-fast5 files from a later timepoint
This configuration gives me the hanging nanopore index
commands.
If I change the sequencing_summary.txt file to be the one created after the run completes the minion
command completes in a few minutes. Is it possible that nanopore index
hangs when the seuqencing_summary.txt file contains a subset of the reads contained in the fast5 files?
from artic-ncov2019.
In this case nanopolish is going to revert to the slow indexing method for the subset of fast5s that haven't been basecalled. If the run progressed well this can mean opening and reading 1000s of files, which takes awhile.
To work around this, I suggest making a directory containing symlinks to the fast5s that are basecalled and present in the sequencing summary, then passing the directory-of-symlinks to nanopolish index
. This is what we do to analyze an in-progress run.
from artic-ncov2019.
Wonderful. Thanks @jts
from artic-ncov2019.
Tried this out and indeed symlinking the fast5s referenced in the sequencing_summary.txt file allows the analysis to take just a minute or two per sample in the pool.
from artic-ncov2019.
Related Issues (20)
- Conda environment dependency issues with new versions of Medaka
- nanopolish index -s failure / prime scheme download failure
- could not find primer scheme and reference sequence, attempting to download
- SARS-CoV-2
- Primer V5.3.2
- Installation via conda (different ways) failed HOT 1
- Artic enviroment does not install after 7 days HOT 2
- V4.1 scheme and primer BED file HOT 3
- Medaka failed: Command failed:longshot -P 0 -F -A --no_haps HOT 1
- multiple references in V4.1 refereces.fasta -> "FASTA has more than one sequence"
- Nanopolish error HOT 3
- Changing Minimum Sequencing Depth Parameter in artic-ncov2019 HOT 1
- Installing ARTIC stuck at Solving environment HOT 1
- artic assembly - Command failed:muscle -in & -out HOT 2
- Midnight primers scheme
- Update to V4/V4.1 under primer-schemes but not artic-ncov2019
- Error running artic minion
- align_trim ValueError: min() arg is an empty sequence (artic 1.2.1) HOT 1
- Error running nanopolish
- Help with vcf_merge HOT 1
Recommend Projects
-
React
A declarative, efficient, and flexible JavaScript library for building user interfaces.
-
Vue.js
🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
-
Typescript
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
-
TensorFlow
An Open Source Machine Learning Framework for Everyone
-
Django
The Web framework for perfectionists with deadlines.
-
Laravel
A PHP framework for web artisans
-
D3
Bring data to life with SVG, Canvas and HTML. 📊📈🎉
-
Recommend Topics
-
javascript
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
-
web
Some thing interesting about web. New door for the world.
-
server
A server is a program made to process requests and deliver data to clients.
-
Machine learning
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
-
Visualization
Some thing interesting about visualization, use data art
-
Game
Some thing interesting about game, make everyone happy.
Recommend Org
-
Facebook
We are working to build community through open source technology. NB: members must have two-factor auth.
-
Microsoft
Open source projects and samples from Microsoft.
-
Google
Google ❤️ Open Source for everyone.
-
Alibaba
Alibaba Open Source for everyone
-
D3
Data-Driven Documents codes.
-
Tencent
China tencent open source team.
from artic-ncov2019.