GithubHelp home page GithubHelp logo

creisle / lamprflp Goto Github PK

View Code? Open in Web Editor NEW
2.0 3.0 1.0 210 KB

JS module for calculating LAMP RFLP fragment lengths

License: MIT License

JavaScript 100.00%
javascript bioinformatics lamp nodejs npm

lamprflp's Introduction

LAMP RFLP

npm version

This is the JS module used by the site: http://creisle.github.io/creisle.lamprflp/

This computes the lamp products from a FASTA input file and outputs the fragments required for the visual

Getting Started

Install from npm

npm install lamprflp

then this can be used in a node module as follows

const {createLampReaction} = require('lamprflp');

const {lanes} = createLampReaction(`
> b1
cgactctagaggatccccgggtac
> b2
tgttgtgtggaattgtgagcggat
> f1
acaacgtcgtgactgggaaaaccct
> f2
gtgcgggcctcttcgctattac
> seq
AATGCTACTACTATTAGTAG...TATGATTTATTGGATGTT
`, ['100bp', '50bp', '', 'RsaI']);

Running the Tests

Tests are written with Jest and can be run as follows

npm test

lamprflp's People

Contributors

creisle avatar dependabot[bot] avatar

Stargazers

 avatar  avatar

Watchers

 avatar  avatar  avatar

Forkers

swipswaps

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.