AmplifyP is a open source cross-platform program for simulating and testing polymerase chain reactions (PCRs). It can be used as a tool for designing primers by evaluating candidates. It is useful for planning experiments as well as for teaching students about PCR.
To use AmplifyP, you supply the DNA sequences of one or more primers plus a length of target DNA sequence, and AmplifyP will generate a map of the expected outcome. It will also provide other helpful information such as the sequences of likely amplified fragments, warnings about potential primer dimers, etc.
AmplifyP is a Python rewrite of William Engels's Amplify 4. For a short history of Amplify, please refer to the history document.
AmplifyP can be used as a graphical user interface (GUI) application (with some screenshots below), however it is written with programmers in mind. The GUI is composed on top of the underlying PCR calculation code, which can be easily accessed programmatically.
| Template & Primer Management | Primer Binding Site & Amplicon | Primer Dimer Analysis |
|
|
|
AmplifyP is available on Linux, Windows and macOS, as well as a web application.
The easiest way to run AmplifyP is to use the web version. The current stable version of AmplifyP is deployed as a static GitHub PAges site:
The binary releases of AmplifyP is available at the GitHub release page:
For Linux, you can either download the AppImage or download the tarball. Both versions are pretty much the same. Some people prefer the AppImage as it is a single binary. However, please note that certain security settings can prevent AppImages from running.
For Windows, you can either download the ZIP file, or the installer. Both versions are pretty much the same. To use AmplifyP, it does not actually need to be installed. However if you run the installer, it would set up shortcuts for you.
For macOS, you can download the DMG file. Please note that I am not a certified Apple Developer, so there will be security warnings. The Mac binary is generated by GitHub workflow. I do not actually have access to a Mac, so I cannot guarantee that the DMG file and the binary inside actually works. The binary generated should be a universal binary.
The web version is for running AmplifyP on your local web server. AmplifyP web version runs purely on client-side, no computation is done on the server itself. However you do actually need to run a static web server and access AmplifyP via the web server. This is due to browser security restriction.
The full user manual for AmplifyP is available here.
I tried to make AmplifyP's GUI intuitive. If you are using AmplifyP for checking existing primers against a DNA template, hopefully you don't need a user manual.
However if you plan to use AmplifyP to design primers using Designer 1D and Designer 2D, you probably want to read the user manual.
When you load the program, the Input View is loaded. You paste in the DNA template on the left-hand side, then you put primers in the table on the right hand side. You then tick the primer that you want to be enabled.
To run PCR simulation, simply click the PCR view at the button bar at the top. To check for primer dimers for the enabled primers, click on the Dimer button.
If you want to highlight a primer or drag it around, click its drag/highlight handle. This controls which primers are copied or dragged around.
The "Copy" button above the primer list works for primers which have been highlighted.
Highlighting is different to enabling / disabling primers for PCR simulation and primer dimer analysis. This distinction was made because some users said they want to be able to highlight the primers in addition to enable and disable them, as this helps them with experiment design.
You can quickly highlight a range of entries in the primer list. If you double click the drag handle of one primer, and double click the drag handle of another primer, the highlight status of the primers between them (including the primers that you double clicked on) will be toggled, that means if they were not highlighted, they will be highlighted now.
If you don't want to run the pre-built binaries, you can run AmplifyP from the source repository. AmplifyP requires Python 3.12 or higher.
To run AmplifyP from the source repository, you need to follow these steps:
-
Clone the repository and navigate to the directory:
git clone https://github.com/fangfufu/AmplifyP.git cd AmplifyP -
Set up the virtual environment:
Debian GNU/Linux: This was verified under Debian GNU/Linux 13 (trixie), I make no guarantee that it works in other Debian derived distributions.
Note
Note that this also sets up your machine for developing AmplifyP. If you don't want that, follow the *nix instructions.
./scripts/setup_linux.sh --system-deps
source .venv/bin/activate*nix, including GNU/Linux distributions, FreeBSD and macOS:
python3 -m venv .venv
source .venv/bin/activate
pip install .Windows:
python -m venv .venv
.venv\Scripts\activate
pip install .If you want to do development on AmplifyP, please refer to the Developers' and Contributors' Guide
It is possible to perform PCR simulation by directly calling AmplifyP's API, bypassing the GUI. If you have a lot of primers and/or a lot of templates, you may wish to write a script of a program go through them, rather than having to click through the GUI. Below is some example code.
from amplifyp.dna import DNA, Primer, DNAType
from amplifyp.pcr import PCR
# Template contains the forward primer at its 5' end and the reverse
# complement of the reverse primer downstream, so one 92 bp amplicon
# is predicted.
template = DNA(
"CGACTGGGCAAAGGAAATCC"
"ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC"
"CCCAAATTTGTGATACCCAC",
DNAType.LINEAR,
name="Template",
)
primer_fwd = Primer("CGACTGGGCAAAGGAAATCC", name="FwdPrimer")
primer_rev = Primer("GTGGGTATCACAAATTTGGG", name="RevPrimer")
pcr = PCR(template)
pcr.add_primer(primer_fwd)
pcr.add_primer(primer_rev)
pcr.predict_amplicons()
for amplicon in pcr.amplicons:
print(
f"Product length: {len(amplicon.product)} bp, Q-score: {amplicon.q_score:.2f}"
)For the full guide on using AmplifyP API, please refer to the Python API Guide
For more documentation, please refer to:
- Amplify History: A brief history of the Amplify software series.
- GUI Manual: A detailed manual for running simulations, primer management, and configuration in the graphical application.
- Python API Guide: A developer guide with code snippets demonstrating programmatic PCR simulation, dimer analyses, and Tm calculations.
- Development Guide: Information on setting up development dependencies, linters, hot-reload, and Pyodide web builds.
- Windows Setup Guide: A step-by-step developer guide for setting up the environment, running tests, and compiling installers on Windows.
- William Engels (Amplify4): This project is based on Amplify4.
- Roboto Mono Font: Licenced under the SIL Open Font License, Version 1.1. Copyright 2015 The Roboto Mono Project Authors.
This project is licensed under the GPL-3.0 Licence. See the LICENSE file for details.


