Problem1 Repeated DNA Sequences (https://leetcode.com/problems/repeated-dna-sequences/)
All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.
Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.
Example:
Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
Output: ["AAAAACCCCC", "CCCCCAAAAA"]
Given a map Map<String, List> userSongs with user names as keys and a list of all the songs that the user has listened to as values.
Also given a map Map<String, List> songGenres, with song genre as keys and a list of all the songs within that genre as values. The song can only belong to only one genre.
The task is to return a map Map<String, List>, where the key is a user name and the value is a list of the user's favorite genre(s). Favorite genre is the most listened to genre. A user can have more than one favorite genre if he/she has listened to the same number of songs per each of the genres.
Example 1:
Input:
userSongs = {
"David": ["song1", "song2", "song3", "song4", "song8"],
"Emma": ["song5", "song6", "song7"]
},
songGenres = {
"Rock": ["song1", "song3"],
"Dubstep": ["song7"],
"Techno": ["song2", "song4"],
"Pop": ["song5", "song6"],
"Jazz": ["song8", "song9"]
}
Output: {
"David": ["Rock", "Techno"],
"Emma": ["Pop"]
}
Explanation:
David has 2 Rock, 2 Techno and 1 Jazz song. So he has 2 favorite genres.
Emma has 2 Pop and 1 Dubstep song. Pop is Emma's favorite genre.