GithubHelp home page GithubHelp logo

hashing-3's Introduction

Hashing-3

All DNA is composed of a series of nucleotides abbreviated as A, C, G, and T, for example: "ACGAATTCCG". When studying DNA, it is sometimes useful to identify repeated sequences within the DNA.

Write a function to find all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule.

Example:

Input: s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"

Output: ["AAAAACCCCC", "CCCCCAAAAA"]

Problem2 Favourite Genres

Given a map Map<String, List> userSongs with user names as keys and a list of all the songs that the user has listened to as values.

Also given a map Map<String, List> songGenres, with song genre as keys and a list of all the songs within that genre as values. The song can only belong to only one genre.

The task is to return a map Map<String, List>, where the key is a user name and the value is a list of the user's favorite genre(s). Favorite genre is the most listened to genre. A user can have more than one favorite genre if he/she has listened to the same number of songs per each of the genres.

Example 1:

Input:

userSongs = {

"David": ["song1", "song2", "song3", "song4", "song8"],

"Emma": ["song5", "song6", "song7"]

},

songGenres = {

"Rock": ["song1", "song3"],

"Dubstep": ["song7"],

"Techno": ["song2", "song4"],

"Pop": ["song5", "song6"],

"Jazz": ["song8", "song9"]

}

Output: {

"David": ["Rock", "Techno"],

"Emma": ["Pop"]

}

Explanation:

David has 2 Rock, 2 Techno and 1 Jazz song. So he has 2 favorite genres.

Emma has 2 Pop and 1 Dubstep song. Pop is Emma's favorite genre.

hashing-3's People

Contributors

kannan-mrugapphan avatar super30admin avatar

Watchers

James Cloos avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.