nanoporetech / bwapy Goto Github PK

I get this error on importing bwapy. Looks like '-lz' flag needs to be passed to the linker somewhere.

Thank you for sharing this very useful code.

I have found that the function 'free_mem_aln_v' does not free memory allocated to alns->aln in the function 'new_mem_aln_v'. This causes a memory issue when calling the align_seq function repeatedly. Adding the line 'free(alns->aln)' to the function fixes this problem.

I think it would be preferable to have an option to build and distribute bwa itself together with bwapy. There are two advantages:

• A possibility to get exactly the same version of the aligner itself in the $PATH when bwapy gets installed (+ for reproducible environments managed via conda, virualenv or similar).
• A possibility to create self-contained tests for the package

The current version on github is further than the one on bioconda (0.1.4), for example it uses bwa mem flag -a. Can you please update bioconda version?

A fresh build of bwapy on Python 3.6 produces no alignments in trivial cases. The index seems to be loaded just fine and I do not now if there is a possible version mismatch between the index format and what bwapy expects.

Create a reference

(align) $ cat test.fa 
>REF         
AAACCCGGGGGGGGGGAAACGC

Index it

(align) $ bwa index test.fa
[bwa_index] Pack FASTA... 0.00 sec         
[bwa_index] Construct BWT for the packed sequence...
[bwa_index] 0.00 seconds elapse.
[bwa_index] Update BWT... 0.00 sec
[bwa_index] Pack forward-only FASTA... 0.00 sec
[bwa_index] Construct SA from BWT and Occ... 0.00 sec
[main] Version: 0.7.17-r1188
[main] CMD: bwa index test.fa
[main] Real time: 0.015 sec; CPU: 0.004 sec

Create a test read

(align) $ cat test.fq
@testread
AAACCC
+
222222

Try to align with bwapy:

(align) $ python3 -c 'import bwapy; print(bwapy.BwaAligner("test.fa").align_seq("AAACCC"))'
()
(align) $ python3 -c 'import bwapy; print(bwapy.__version__)'
0.1.4

Try to align with bwa mem

(align) $ bwa mem test.fa test.fq
[M::bwa_idx_load_from_disk] read 0 ALT contigs
@SQ     SN:REF  LN:22
@PG     ID:bwa  PN:bwa  VN:0.7.17-r1188 CL:bwa mem test.fa test.fq
[M::process] read 1 sequences (6 bp)...
[M::mem_process_seqs] Processed 1 reads in 0.001 CPU sec, 0.001 real sec
testread        4       *       0       0       *       *       0       0       AAACCC  222222  AS:i:0  XS:i:0
[main] Version: 0.7.17-r1188
[main] CMD: bwa mem test.fa test.fq
[main] Real time: 0.002 sec; CPU: 0.004 sec

This is a nice project, but it would be really cool if mappy/minimap2 and bwapy happened to share the same python api.

Does this package work with python3? I'm getting this error:

AttributeError: type object 'Cython.Compiler.Scanning.Method' has no attribute '__reduce_cython__'

when I run:

python3 setup.py install --user

Any idea how to make it work for python3?