oicr-gsi / bwamem

Workflow for BWA mem

bwaMem

This workflow aligns sequence data provided as fastq files against a genomic reference using bwa (burrows-wheeler-aligner). Prior to alignment, there are options to remove 5' umi sequence and to trim off 3' sequencing adapter. Readgroup information to be injected into the bam header needs to be provided. The workflow can also split the input data into a requested number of chunks, align each separately then merge the separate alignments into a single bam file. This decreases the workflow run time. Optional bwa mem parameters can be provided to the workflow.

Overview

Dependencies

• bwa 0.7.17
• samtools 1.9
• cutadapt 1.8.3
• slicer 0.3.0
• python 3.7
• barcodex-rs 0.1.2
• rust 1.2
• gsi software modules : samtools 1.9 bwa 0.7.17
• gsi hg38 modules : hg38-bwa-index-with-alt 0.7.17
• gsi hg19 modules : hg19-bwa-index 0.7.17
• gsi mm10 modules :mm10-bwa-index 0.7.17

Usage

Cromwell

java -jar cromwell.jar run bwaMem.wdl --inputs inputs.json

Inputs

Required workflow parameters:

Parameter	Value	Description
fastqR1	File	Fastq file for read 1
outputFileNamePrefix	String	Prefix for output files
reference	String	The genome reference build. For example: hg19, hg38, mm10
runBwaMem.readGroups	String	The readgroup information to be injected into the bam header

Optional workflow parameters:

Parameter	Value	Default	Description
fastqR2	File?	None	Fastq file for read 2
numChunk	Int	1	Number of chunks to split fastq file [1, no splitting]
doUMIextract	Boolean	false	If true, UMI will be extracted before alignment [false]
doTrim	Boolean	false	If true, adapters will be trimmed before alignment [false]
numReads	Int?	None	Number of reads

Optional task parameters:

Parameter	Value	Default	Description
countChunkSize.modules	String	"python/3.7"	Required environment modules
countChunkSize.jobMemory	Int	16	Memory allocated for this job
countChunkSize.timeout	Int	48	Hours before task timeout
slicerR1.modules	String	"slicer/0.3.0"	Required environment modules
slicerR1.jobMemory	Int	16	Memory allocated for this job
slicerR1.timeout	Int	48	Hours before task timeout
slicerR2.modules	String	"slicer/0.3.0"	Required environment modules
slicerR2.jobMemory	Int	16	Memory allocated for this job
slicerR2.timeout	Int	48	Hours before task timeout
extractUMIs.umiList	String	"umiList"	Reference file with valid UMIs
extractUMIs.outputPrefix	String	"extractUMIs_output"	Specifies the start of the output files
extractUMIs.pattern1	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
extractUMIs.pattern2	String	"(?P<umi_1>^[ACGT]{3}[ACG])(?P<discard_1>T)	(?P<umi_2>^[ACGT]{3})(?P<discard_2>T)"
extractUMIs.modules	String	"barcodex-rs/0.1.2 rust/1.45.1"	Required environment modules
extractUMIs.jobMemory	Int	24	Memory allocated for this job
extractUMIs.timeout	Int	12	Time in hours before task timeout
adapterTrimming.modules	String	"cutadapt/1.8.3"	Required environment modules
adapterTrimming.doUMItrim	Boolean	false	If true, do umi trimming
adapterTrimming.umiLength	Int	5	The number of bases to trim when doUMItrim is true. If the given length is positive, the bases are removed from the beginning of each read. If it is negative, the bases are removed from the end
adapterTrimming.trimMinLength	Int	1	Minimum length of reads to keep
adapterTrimming.trimMinQuality	Int	0	Minimum quality of read ends to keep
adapterTrimming.adapter1	String	"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC"	Adapter sequence to trim from read 1
adapterTrimming.adapter2	String	"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT"	Adapter sequence to trim from read 2
adapterTrimming.addParam	String?	None	Additional cutadapt parameters
adapterTrimming.jobMemory	Int	16	Memory allocated for this job
adapterTrimming.timeout	Int	48	Hours before task timeout
runBwaMem.addParam	String?	None	Additional BWA parameters
runBwaMem.threads	Int	8	Requested CPU threads
runBwaMem.jobMemory	Int	32	Memory allocated for this job
runBwaMem.timeout	Int	96	Hours before task timeout
bamMerge.jobMemory	Int	32	Memory allocated indexing job
bamMerge.modules	String	"samtools/1.9"	Required environment modules
bamMerge.timeout	Int	72	Hours before task timeout
indexBam.jobMemory	Int	12	Memory allocated indexing job
indexBam.modules	String	"samtools/1.9"	Modules for running indexing job
indexBam.timeout	Int	48	Hours before task timeout
adapterTrimmingLog.jobMemory	Int	12	Memory allocated indexing job
adapterTrimmingLog.timeout	Int	48	Hours before task timeout

Outputs

Output	Type	Description	Labels
bwaMemBam	File	Output Alignment BAM file	vidarr_label: bwaMemBam
bwaMemIndex	File	Index of the Output Alignment file, BAI	vidarr_label: bwaMemIndex
log	File?	Optional log file	vidarr_label: log
cutAdaptAllLogs	File?	Optional log file for cutAdapt	vidarr_label: cutAdaptAllLogs

Commands

This section lists command(s) run by bwaMem workflow

Split the fastq files into chunks to parallelize the alignment (optional). If requested, subsequent steps will be run on each fastq chunk

         if [ -z "~{numReads}" ]; then
             totalLines=$(zcat ~{fastqR1} | wc -l)
         else totalLines=$((~{numReads}*4))
         fi
 
         python3 -c "from math import ceil; print (int(ceil(($totalLines/4.0)/~{numChunk})*4))"
 	slicer -i ~{fastqR} -l ~{chunkSize} --gzip

Trim off the UMI bases (optional)

             barcodex-rs --umilist ~{umiList} --prefix ~{outputPrefix} --separator "__" inline \
             --pattern1 '~{pattern1}' --r1-in ~{fastq1} \
             ~{if (defined(fastq2)) then "--pattern2 '~{pattern2}' --r2-in ~{fastq2} " else ""}
 
             cat ~{outputPrefix}_UMI_counts.json > umiCounts.txt
 
             tr [,] ',\n' < umiCounts.txt | sed 's/[{}]//' > tmp.txt
             echo "{$(sort -i tmp.txt)}" > new.txt
             tr '\n' ',' < new.txt | sed 's/,$//' > ~{outputPrefix}_UMI_counts.json

Trim off adapter sequence (optional)

         cutadapt -q ~{trimMinQuality} \
                 -m ~{trimMinLength} \
                 -a ~{adapter1} \
                 -o ~{resultFastqR1} \
                 ~{if (defined(fastqR2)) then "-A ~{adapter2} -p ~{resultFastqR2} " else ""} \
                 ~{if (doUMItrim) then "-u ~{umiLength} -U ~{umiLength} " else ""} \
                 ~{addParam} \
                 ~{fastqR1} \
                 ~{fastqR2} > ~{resultLog}

Align to reference with bwa mem

         mkdir -p ~{tmpDir}
         bwa mem -M \
             -t ~{threads} ~{addParam}  \
             -R  ~{readGroups} \
             ~{bwaRef} \
             ~{read1s} \
             ~{read2s} \
         | \
         samtools sort -O bam -T ~{tmpDir} -o ~{resultBam} - 

Merge parallelized alignments (optional, if the fastq had been split)

         samtools merge \
         -c \
         ~{resultMergedBam} \
         ~{sep=" " bams} 

Index the bam file

         samtools index ~{inputBam} ~{resultBai}

Merging of parallelized Adapter trimming logs

        COMMANDS NOT SHOWN, see WDL for details

Support

For support, please file an issue on the Github project or send an email to [email protected] .

Generated with generate-markdown-readme (https://github.com/oicr-gsi/gsi-wdl-tools/)