Authors:
Peter Menzel [email protected]
Stefan Seemann [email protected]
Copyright 2012,2018 Peter Menzel, see file LICENCE
RILogo is a command line program to create an RNA-RNA interaction logo from a pair of RNA sequences or alignments and outputs an SVG file. If alignments are given as input, then RILogo displays them as sequence logos. Intramolecular base pairs are displayed by arcs connecting the corresponding columns of the sequence logo. Intermolecular base pairs are denoted by connecting lines between both logos.
RILogo calculates the mutual information for base pairs and displays it through a colour gradient in the connecting arcs and lines. Additionally an 'M' character is placed on top of the other 4 letters in the sequences logos.
The source code of RILogo is available at http://github.com/pmenzel/RILogo
A web server is available at http://rth.dk/resources/rilogo
RILogo is published in:
P. Menzel, S.E. Seemann, J. Gorodkin
RILogo: Visualising RNA-RNA interactions
Bioinfomatics, 2012 Oct 1;28(19):2523-6
RILogo is distributed as open source software under the GNU Lesser General Public Licence 3, see the file LICENCE.
RILogo is written in C++ for Linux. It does not depend on
additional libraries. To compile from source, simply type make
and the
program will be compiled into the binary file RILogo
.
RILogo expects either one or two input files that contain the sequences as arguments, or can read a single input file from STDIN.
RILogo [options] file1.fa [file2.fa] >output.svg
or
RILogo [options] <file.fa >output.svg
The input is either a single file or two files in FASTA alignment format.
In the former case, the sequences of the two interacting RNAs need to be
separated by the &
character. All lines have to be of the same length. A
secondary structure annotation has to be given in a special line with the
name structure
. Base pairs are denoted in the dot-bracket notation, see
examples below.
Interactions between the two RNAs can be denoted in the structure line only by
uppercase letters on the left side and corresponding lowercase letters on the
right side of the separator &
. Additionally uppercase and lowercase letters
can be used together on one side exclusively to denote pseudoknots.
Simple internal structure, denoted by brackets, and interaction, denoted by AA
and aa
.
>seq1
AACGTAACGTAAACGAA&AACGTAAACGAAACGAA
>structure
..(((..BBB..)))..&..(((..bbb..)))..
Internal structure on the left side containing a pseudoknot, which is denoted by AA
and aa
.
The interaction is denoted by BB
and bb
.
>seq1
AGCTAGCTAAGCTAAAGCAAAGCAA&AACGAGCCGTAA
>structure
.AAA.(((..BBB..aaa..)))..&.(((bbb)))..
This example shows the interaction between the bacterial small RNA OxyS and
its binding site in the fhlA mRNA. See the files fhlA-OxyS.fa
for the
alignment, fhlA-OxyS.tree
for the calculated phylogenetic tree, and
fhlA-OxyS.treedist
for the tree distances. The output of RILogo with default options using the command
RILogo -t fhlA-OxyS.treedist fhlA-OxyS.fa > fhlA-OxyS.svg
is in the file fhlA-OxyS.svg
.
-m NAME Specify name of mutual information measure.
Options are 'mi' and 'miwp'. Default is 'miwp'.
-t FILENAME Switch to treeMI or treeMI^WP (depending on parameter -m) measure and
specify the name of the file with the average tree distances.
-w Use N_d instead of N in the weighting of observed and expected base pair frequencies.
-c FILENAME Read configuration from file.
-d Debug mode
-g Debug mode for SVG output
-v Verbose mode, prints calculated MI values to STDERR
The script nw_avg_dist.pl
can be used to calculate the pairwise distances
from a phylogenetic tree in Newick format (uses BioPerl), which can be used
with option -t
in RILogo.
RILogo outputs a single vector graphics file in SVG format, which is written to STDOUT.
The SVG file can easily be converted to other file formats, for example with one of these commands, either using Inkscape or ImageMagick:
inkscape -f in.svg -A out.pdf
inkscape --export-png=out.png --export-width=800 in.svg
convert in.svg out.png
RILogo can read a configuration file using option -c
to customise the output.
See default.cfg
for the customisable parameters and their
default values in RILogo.