GithubHelp home page GithubHelp logo

sammarfy / irspot-sf Goto Github PK

View Code? Open in Web Editor NEW

This project forked from marufmd/irspot-sf

0.0 0.0 0.0 13.49 MB

Prediction of Recombination Hotspots using Sequence Based Features

Python 100.00%

irspot-sf's Introduction

iRSpot-SF

Prediction of Recombination Hotspots using Sequence Based Features

Installation

No installation needed. Just download the files in a folder or download the iRSpot-SF-master.tar.gz file and extract it into your local directory. Following prerequisites are required to run the software.

  1. Install python 3.4 or latest version
  2. Install following python packages:
    • numpy
    • pandas
    • sklearn

Run the software:

Step 1: Go to the folder "input". Open the text file "input.txt". Enter the DNA query sequence in FASTA format.

Example of a DNA sequence in FASTA format:

>YDL087C 1.67     
ATGTCAACTATGTCAACGCCTGCCGCAGAACAACGCAAACTCGTCGAACAGCTGATGGGCAGGAC 
TTCAGTTTCCGCCACAACAGGTATTCGCATCAAAAAAGAGACCTCGGACTACACGATCCAAGATC 
TGCAAGTCATACCTTGTTGGCGAGTGCCCCTACGACCTGTTTCAGGGCACCAACAGAGCCTGGGA 
AAATGCCCGCAGATGCATCTTACCAAGCATAAAATTCAGTACGAGAGAGGGTCAAGCAGGGCAAA 
ACGTTTCCCGAATTCGAAAGAGAATATCTGGCCATTCTATCTCGGTTGTTAATGAGTGTAATGGC 
CAGATATCCGTAGCACTACAAAATCTAAAACACACCGCTGAGAACGAATGAAGATTCAGCAGGTT 
ACCGAAGAACTAGATGTCTTGGACGTGCGGATAGGCCAATGGGACAAGAGATTGATTCTTTAATT 
CGTGCAGATGAAGTCAGTATGGGTATGCTACAGCAGTCAAATTACAAGAACTGATTAGTAAAAGG 
AAAGAAGTTGCAAAACGTGTACGAAACATACAGAAAACGTGGGCCAGAGCGCCCAGCAAAAGTTA 
CAGGTTTGCGAGGTGTGTGGGGCATCCTATCGCGTTTAGATACAGACAGAAGGCTTGCTGACCAC 
TTCTTGGGGAAGATTCATCTGGATATGTCAAGATGAGAGAGGATTATGATCGGCTAATGAAGAAT 
AACCGGACAACTAACGCAGCAAGACAGCTACTACACTACCCGGAAGACGCTTTGTGTA

Step 2: Type the following command in the terminal:

$ python  model.py

Step 3: Go to the folder "output". Open the text file "output.txt". It will show you the prediction for the DNA query sequence of "input.txt". HOT is shown for HOTSPOT and COLD for COLDSPOT. For the sample DNA sequence it'll show:

HOT

N.B., If the DNA sequence is not in FASTA format, it will not predict anything.

irspot-sf's People

Contributors

marufmd avatar samu14792 avatar

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.