schultzm / cris Goto Github PK

Use print() function rather than print, and add from __future__ import print_function on the first line of the file.

You can then use print( str, file = sys.stderr) for verbose messages. Remember to add import sys.

Finally, put the messages into its own function:

import sys

def msg( str ):
    print( str, file = sys.stderr )

You can even add a timestamp:

import datetime
import sys

def msg( str ):
    print( "[{:%Y-%m-%d %H:%M:%S}]: {}".format(datetime.datetime.now(), str), file = sys.stderr )

Best hit for gene       SAOUHSC_00009   was     GATCGTGCAGCAAAAGTTTCAGG at pos  [13241:13264](+)

Can you print both the locus_tag AND the gene for each thing so it lines up better?

Artemis does not support multi-Genbank files.

(when it becomes more mature that is)

Mark

Instead of this:

        loc_strt = feature.location.start.position
        loc_end = feature.location.end.position
        loc_strnd = feature.location.strand
        locus_locations[locus_name].append([loc_strt, loc_end, loc_strnd])

Can you just do this?

    locus_locations[locus_name].append( feature.location )

instead of breaking it down and re-storing it in a list, just re-use the python object as it was intended?

I don't like hard-coded output filenames.

Could you make sys.stdout the default output?

ie. outfile = os.path.splitext(ARGS.seq_infile)[0]+'_CRISPRCas9targetsites.gbk'

I just use GPLv3 but I don't have any good arguments for that choice.

See
https://en.wikipedia.org/wiki/Comparison_of_free_and_open-source_software_licenses

I don't think you need {1} .

Really needs a targets.tab output file which has TSV with these columns:

1. sequence ID
2. location
3. feature type
4. feature ID (locus tag / gene)
5. 23-mer string

Filename should be an output parameter.