seth-1 / blast_app

blast_app

Running the application

To run the application you'll need to:

• clone this github repository
• run docker-compose up
• migrate the database docker-compose exec web python manage.py migrate
• open firefox/ chrome or another browser and visit http://localhost:3000/
• copy paste a DNA sequence and click Submit to create a BLASTx job
• The results will be displayed below the sequence input after refreshing the page

You can try the sequence submission with the following sequence:

ATGTTTAGAAAAAAATATACTAAAAAAATTAGTCCAACAGTTTTGTCAAAATTCCTAGAGCTTTACAAAG
ACAAGCAACCCAAATATGTTAAAATATTATTAAATAGATATAATAATCCATATCTTCGTACAAATCAAAC
GATCAAATCCCCTTTTCATACAAAGTCTTCAAAAAACAAATGTATTAAAAAAAATAAACATAGTATTAAA
AAATTAATTAATTTTTAA

Data retrieval

Creating a blastable database

Blast databases include proteins of the following NCBI entries: ​NC_000852, NC_007346, NC_008724, NC_009899, NC_014637, NC_020104, NC_023423, NC_023640, NC_023719, NC_027867.

Sequences have been downloaded from NCBI proteins written in fasta format to blast_application/data/proteins.fasta Database was prepared using makeblastdb -dbtype prot -in proteins.fasta.