wurmlab / sbc361-programming-in-r

QMUL's programming in R course

Programming in R

This is part of QMUL's year 3 SBC361 Research Methods and Communication II course.

There are generally 3 practicals:

• Introduction to R and Regular expressions
• functions and for loops
• practice exercises

Put any public file in the "public" folder.

Practicals are now organised by year. Each year has a relevant README.

Contributors

Yannick Wurm, Rodrigo Pracana, Bruno Vieira, Bob Verity.

sbc361-programming-in-r's Issues

Prac2: function with multiple arguments

Q3 (additional_hours) is confusing because it is asking from an arbitrary action (adding an arbitrary number of hours to the output of time_converter).

An alternative is to ask the students to create the reverse of time_converter:

hours_to_seconds <- function(hours, minutes, seconds) {
  total_ hours <- hours + minutes/60 + seconds/3600
  return(total_ hours)
}

We could also update the name of time_converter to something more descriptive (e.g. hours_minutes_seconds).

Question_31_32_Practical1 explanations

I have made some changes/suggestions to Question_31_32_Practical1.md in 930592a However some work is still needed. This includes:

• please reorder so that "x" is first, then repl, then pattern (as the pattern is the only thing changing it should be easy to see that that is the only thing changing)
• please test all of them (I wrote things from memory and so havnett tested any of them) - you may need to adjust so they work.
• put the "two step" versions before the 1 step versions
• when creating a temp variable, subsequently delete it
• rewrite the last one without the confusing \w and \s. Better to be more specific. Similarly, don't use 'sub'. Finally, avoid "*" in favor of "+"

Practical 2: missing bracket in 'Slightly more complex loops'

just need one at the arrow to close the 'print'

practical 1: Confusion between logical and regular expressions

"Q30. How many reptile names (genus or species) contain a lowercase "o" or an uppercase "E"?
Hint - you will have to combine your knowledge of regular expressions with your knowledge of logical expressions to answer this one!"

This could be asking students to use logical expression, although they have not been taught to use grepl:

grepl("o", x) | grepl("E", x)

On the other hand, this could be asking students to use regular expression "alternation", which the practical does not explain, and which in my mind differs from traditional logical expressions:

grep("(o|E)", x)  # Possibility 1
grep("[oE]", x)  # Possibility 2

practical1.md

A few things noticed today (i'm sure you will also have found things that should be addressed before friday):

• When they are subsetting the puromycin table, the subset() approach is preferred. It should thus come before the confusing [,] approach
• When calling a function such as subset, we should name the arguments, e.g. subset(x = puromycin_data, subset = conc < rate)

prac3

On 2017-Oct-23, at 20:19, Yannick Wurm [email protected] wrote:

"The second half of this session will be the exam"

"For example, ACCTAGGT is a palindromic DNA sequence as its complement is TGGATCCA." - not quite.
(we shouldn't use the word "as" in general because it is ambiguious)

http://wurmlab.github.io/SBC361-programming-in-R/ButterflySample.csv"
butterfly_ref_url <-
"http://wurmlab.github.io/SBC361-programming-in-R/ButterflyReference.csv"

--> better to do everything in lowercase with '_' delimiter

urveys in two locations (A and B

--> what are they?

ignore.case = T
--> TRUE

Exam Reminders....

You are allowed to use the internet and your class notes during the exam, but you are not allowed to use chat or forums to ask for answers and you are not allowed to copy off one another.
-> I think that they will not be allowed anything other than QMPlus.

header = T)

--> TRUE

Q8: They were already imported

I don't think we should mention if as it should be unnecesasry

@MartinezRuiz-Carlos

practical 2: need feedback on nested loop example

It is an example in Nested loop paragraph:

coffee_drinks <- c("latte", "cappuccino", "espresso", "flat white", "cortado")
coffee_places <- c("Infusion", "Ground", "Sugar Cube", "Foxcroft & Ginger", "Sweet")

for (the_drink in 1:length(coffee_drinks)) {
  for (the_place in 1:length(coffee_places)) {
    print(paste("I'd like a", coffee_drinks[the_drink], "from", coffee_places[the_place]))
  }
}

Does it represent what we wanted?

add in pen and paper questions?

need published to web please

in same way as msc course
thanks v much

@MartinezRuiz-Carlos @yeban

Practical 2 is too long

Most students become stuck at question 14, few go on to the "working with DNA" section

Practical 0

Broken formatting -

Possibly incomplete example -

Possibly confusing -

practical 2 question 14

This question is quite difficult for someone who has just only learned what a for loop is. It is difficult to understand why you would need a nested for loop, and why you would need an extra index.

practical 2 and 3

Examples with matrices want to become data frames - because this allows subsetting by columns.

practical 2: webpage version does not have the ant table

I am not so sure why. @yeban would you know?

It should look like that (from md file):

But it looks like that on the website:

shift from pandoc to using standard jekyll / github-pages - like @discoform did for the genomciscourse practical repo

Practical 2 question 16

This question asks to generate the reverse complement of a sequence using "gsub". Using "gsub" is quite dangerous in this question. A better solution is to use "match", despite this not being the point of the exercise:

sequence <- "ATTACGACGCGATTCCCGGTTAATCGAATTCCCA"

# Complement of each nucleotide
dna_code               <- c("A","C","G","T")
complement_code <- c("T","G", "C","A")

# Complement of sequence
comp_seq <- complement_code[match(sequence, dna_code)]

# Reverse
rev_comp <- rev(rev_comp)

# paste together
rev_comp <- paste(rev_comp, collapse = "")

prac3 URLs need testing/updating

q7 complicated phrase

prac 2/3 matrix -> data frame

Probably we want to prioritise data frames

Practical 1 starts at Q26

Should it start in Q1?

plot

of bank balance wants to replaced with ggplot
(just give example command)

Modern deployment & UI

• #37
• #39
• #38

add info message on non-2021 pages to link to 2021 page

prac 2

helianthus data is giving 404

serve from wurmlab.com/programming-in-R (and add appropriate redirect - likely within the wurmlab repo)

master and gh-pages out of sync

Can this be automated? and a "simple" (github-equivalent) github theme be autoapplied? So we just direct studnets to e.g. http://wurmlab.github.io/SBC361-programming-in-R/Question_31_32_Practical1.html ? thanks,
Yannick

data for Q.13 of prac 2 still stored in antgenomes.org instead of github

We need to migrate http://www.antgenomes.org/~yannickwurm/tmp/HelianthusData_num.txt to github.

I'm not doing it now because I don't want to break the link 20 minutes before the practical.

Question Intro 4 in Practical 3

This questions needs to be changed or removed, as it is quite pointless and confusing. This needs to be done after the exam happens, the 2nd November 2018

Practical 2: nrow instead of nrows

Question 14 typo - first line of code

Students get confused with the "+" in the console

I.e. when they don't close a bracket....

practical 2: questions are not well delimited

for next year, need a better typographic break between Q3 and Q4

Todos for 2017

• "intro" is something they should already know. Name it practical0. Keep regex as practical1
• @EmelineAurore identified a few places with issues. Please identify them more clearly here and/or directly resolve them BEFORE other assistants work through the practicals
• put our css on it.
• shift URLs to this year's verison

prac2 q1

• "before evaluating" the R code -> "before testing"
• q2 fields -> rows
• q3: should be more complex.
• delete "The general construct of a"
• rename "my_first_function" to something relevant
• (don't worry too much about the computation in the middle) -> (floor() is R's built-in function function for rounding down to the closest whole number)
• "run it on the numbers 5, 50000, and 10000000 seconds" -> use relevant examples for testing (0, 3600, another)

prac 2 q7 and q8 and stupid to the point of being useless...

can we get coderay syntax highlighting to work here?

https://jekyllrb.com/docs/configuration/markdown/