iqtlabs / squiggle Goto Github PK
View Code? Open in Web Editor NEW๐ DNA Sequence Visualization for Humans
Home Page: https://squiggle.readthedocs.io
License: MIT License
๐ DNA Sequence Visualization for Humans
Home Page: https://squiggle.readthedocs.io
License: MIT License
This requires:
Hi,
I have installed squiggle by pip3 but I got this error in running examples:
squiggle ecol.heg.fasta
Visualizing each sequence in black.
0%| | 0/274 [00:00<?, ? seqs/s]BokehDeprecationWarning: 'legend' keyword is deprecated, use explicit 'legend_label', 'legend_field', or 'legend_group' keywords instead
Traceback (most recent call last):
File "/usr/local/bin/squiggle", line 11, in
load_entry_point('squiggle==0.3.1', 'console_scripts', 'squiggle')()
File "/usr/local/lib/python3.6/dist-packages/click/core.py", line 722, in call
return self.main(*args, **kwargs)
File "/usr/local/lib/python3.6/dist-packages/click/core.py", line 697, in main
rv = self.invoke(ctx)
File "/usr/local/lib/python3.6/dist-packages/click/core.py", line 895, in invoke
return ctx.invoke(self.callback, **ctx.params)
File "/usr/local/lib/python3.6/dist-packages/click/core.py", line 535, in invoke
return callback(*args, **kwargs)
File "/usr/local/lib/python3.6/dist-packages/squiggle/cli.py", line 223, in visualize
color=seq.color)
File "/usr/local/lib/python3.6/dist-packages/bokeh/plotting/_decorators.py", line 54, in wrapped
return create_renderer(glyphclass, self, **kwargs)
File "/usr/local/lib/python3.6/dist-packages/bokeh/plotting/_renderer.py", line 126, in create_renderer
update_legend(plot, legend_kwarg, glyph_renderer)
File "/usr/local/lib/python3.6/dist-packages/bokeh/plotting/_legends.py", line 56, in update_legend
_LEGEND_KWARG_HANDLERS[kwarg](value, legend, glyph_renderer)
File "/usr/local/lib/python3.6/dist-packages/bokeh/plotting/_legends.py", line 82, in _handle_legend_deprecated
raise ValueError("Bad 'legend' parameter value: %s" % label)
ValueError: Bad 'legend' parameter value: None
The only fasta that I can successfully run is
lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
lcl|NC_005100.4_cds_NP_150237.1_1 [gene=HBB]
ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGGGGAAAGGTGAACCCTGATGATG
TTGGTGGCGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGAGGTACTTTGATAGCTTTGG
GGACCTGTCCTCTGCCTCTGCTATCATGGGTAACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGATAAAC
GCCTTCAATGATGGCCTGAAACACTTGGACAACCTCAAGGGCACCTTTGCTCATCTGAGTGAACTCCACT
GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACATGATTGTGATTGTGTTGGGCCA
CCACCTGGGCAAGGAATTCTCCCCCTGTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCAGT
GCCCTGGCTCACAAGTACCACTAA
Wouldn't it be better to use curves (i.e., shapes) of equal areas for each of the nucleotides? Right now, A and C have areas of + and - 0.25 units respectively, while G and T have areas of + and - 0.5 units respectively.
In some applications, like data storage in DNA, it is likely that optimal encodings have an equal number of each of the nucleotides, and having balanced representations could make it easier to spot imbalances and thereby compare different encodings visually.
This won't eliminate any of the other benefits stated in the blog post, but I think it will broaden the application of this visualization.
We should just be able to use a named tuple instead.
For simplicity, we'll use the DNAvisualization.org logo
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.