GithubHelp home page GithubHelp logo

iqtlabs / squiggle Goto Github PK

View Code? Open in Web Editor NEW
39.0 6.0 9.0 4.32 MB

๐Ÿ“ˆ DNA Sequence Visualization for Humans

Home Page: https://squiggle.readthedocs.io

License: MIT License

Python 100.00%
dna visualization

squiggle's Introduction

This repository has moved to https://github.com/Benjamin-Lee/squiggle

DOI Build Status Docs PyPI

Squiggle is a two-dimensional DNA sequence visualization library that can turn FASTA sequence files like this:

>lcl|NC_000011.10_cds_NP_000509.1_1 [gene=HBB]
ATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAA
>lcl|NC_005100.4_cds_NP_150237.1_1 [gene=HBB]
ATGGTGCACCTGACTGATGCTGAGAAGGCTGCTGTTAATGGCCTGTGGGGAAAGGTGAACCCTGATGATG
TTGGTGGCGAGGCCCTGGGCAGGCTGCTGGTTGTCTACCCTTGGACCCAGAGGTACTTTGATAGCTTTGG
GGACCTGTCCTCTGCCTCTGCTATCATGGGTAACCCTAAGGTGAAGGCCCATGGCAAGAAGGTGATAAAC
GCCTTCAATGATGGCCTGAAACACTTGGACAACCTCAAGGGCACCTTTGCTCATCTGAGTGAACTCCACT
GTGACAAGCTGCATGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACATGATTGTGATTGTGTTGGGCCA
CCACCTGGGCAAGGAATTCTCCCCCTGTGCACAGGCTGCCTTCCAGAAGGTGGTGGCTGGAGTGGCCAGT
GCCCTGGCTCACAAGTACCACTAA

into gorgeous, interactive visualizations like this:

Human Squiggle

(Click the picture to view an interactive version.)

Installation

If you don't have Python 3.5 or greater installed, be sure to get it. To get the current stable version of Squiggle, run:

$ pip install squiggle

Or, alternatively, if you want to get the latest development version:

$ pip install git+https://github.com/Lab41/squiggle.git

Usage

Using Squiggle is as easy as:

$ squiggle your_sequence.fasta

Squiggle has tons of options available to make beautiful, interactive visualizations of DNA sequences. To get a full rundown of the various option, take look at the documentation here.

Citation

Using Squiggle in your research? Please cite it!

  • Lee, B. D. (2018). Squiggle: a user-friendly two-dimensional DNA sequence visualization tool. Bioinformatics. doi:10.1093/bioinformatics/bty807
@article{Lee2018,
  doi = {10.1093/bioinformatics/bty807},
  url = {https://doi.org/10.1093/bioinformatics/bty807},
  year  = {2018},
  month = {sep},
  publisher = {Oxford University Press ({OUP})},
  author = {Benjamin D Lee},
  editor = {John Hancock},
  title = {Squiggle: a user-friendly two-dimensional {DNA} sequence visualization tool},
  journal = {Bioinformatics}
}

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.