ldiao / mixmir Goto Github PK

Hello,
I got the result and I have a question. So, from this program, I can get the miRNA which is predicted to bind the mRNA based on the log fold change of genes. The output file is a CSV file of miRNA matched to a motif with p-value ranked from the lowest to a certain number of rank. Is it possible to know what gene are those miRNA bind to? All I can get is the rank, motif, p-value, coef, NUTRs, and miRNA matched. I want to know what gene paired with what miRNA. I attached my result file. Thank you.
BDC_647-MixMir-results.txt

Hi,
I am trying to ru MixMir, now working with your testdata, but I get this error with my own data.
('No refseq ID detected', '>TRINITY_GG_86181_c0_g1_i4')
Can MixMir be run with my own fasta file regardless of its headers?
fasta headers example:

TRINITY_GG_86181_c0_g1_i4
TRINITY_GG_128934_c0_g1_i8
TRINITY_GG_52087_c0_g1_i1
TRINITY_GG_29872_c0_g1_i3
TRINITY_GG_93846_c0_g1_i2
TRINITY_GG_137216_c0_g1_i7
TRINITY_GG_103307_c1_g1_i3
TRINITY_GG_60964_c0_g1_i6
TRINITY_GG_86691_c1_g1_i7
TRINITY_GG_3149_c0_g1_i12

I got error:

Solving MLM with GEMMA
Parsing files for PLINK
Removing 4096 motifs with no information
/usr/local/lib/python2.7/dist-packages/numpy/core/_methods.py:59: RuntimeWarning: Mean of empty slice.
  warnings.warn("Mean of empty slice.", RuntimeWarning)
/usr/local/lib/python2.7/dist-packages/numpy/core/_methods.py:68: RuntimeWarning: invalid value encountered in true_divide
  ret, rcount, out=ret, casting='unsafe', subok=False)
/usr/local/lib/python2.7/dist-packages/numpy/lib/function_base.py:2079: RuntimeWarning: Degrees of freedom <= 0 for slice
  warnings.warn("Degrees of freedom <= 0 for slice", RuntimeWarning)
/usr/local/lib/python2.7/dist-packages/numpy/lib/function_base.py:2087: RuntimeWarning: invalid value encountered in true_divide
  return (dot(X, X_T.conj())/fact).squeeze()
Traceback (most recent call last):
  File "MixMir.py", line 157, in <module>
    doAll(doKin=doKin)
  File "MixMir.py", line 18, in doAll
    runParse(doKin=doKin)
  File "MixMir.py", line 43, in runParse
    parseAll.doAll(doKin=doKin,seqf=seqf,exprf=exprf,outfnkin=kinf,outPedFile=outPedFile,outMapFile=outMapFile,kkin=kkin,kmotif=kmotif,frac=frac,useFast=useFast)
  File "/media/bharata/1TB_1/MixMir/parseAll.py", line 64, in doAll
    makeKin(dcounts=kin_dcounts,genes=genes,outfn=outfnkin,useFast=useFast) 
  File "/media/bharata/1TB_1/MixMir/parseAll.py", line 247, in makeKin
    np.savetxt(outfn,K,delimiter='\t',fmt='%.4f')
  File "/usr/local/lib/python2.7/dist-packages/numpy/lib/npyio.py", line 1116, in savetxt
    ncol = X.shape[1]
IndexError: tuple index out of range

I really don't understand why. My input is like this:

For mature.fa, I downloaded from the database.
For the UTR fasta, I already create a fasta according to the input format

>refGene_NM_001662 range=7:127591299-127591705  5'pad=0 3'pad=0 strand=+ repeatMasking=none
CCAGCCAGGGGCAGGCCCCTGATGCCCGGAAGCTCCTGCGTGCAT

For the gene expresion file, my file:

ENST00000616518     1.11843
ENST00000620773     0
ENST00000619103     0
ENST00000611520     1.11843
ENST00000390393     2.23687
ENST00000390394     4.47373
ENST00000542354     1.11843

Hi I have installed MixMir and I keep getting this error when trying to run the testate but I don't know how to solve it. Any idea what could it be?

python MixMir.py --seqf testdat/test-utrs.fa --exprf testdat/test-exprs.txt --mirf testdat/testmirs.fa --k_kin 6 --k_motif 6 --N 20 --fast 0
Solving MLM with GEMMA
Parsing files for PLINK
Removing 418 motifs with no information
Removing 418 motifs with no information
Traceback (most recent call last):
File "MixMir.py", line 157, in
doAll(doKin=doKin)
File "MixMir.py", line 18, in doAll
runParse(doKin=doKin)
File "MixMir.py", line 43, in runParse
parseAll.doAll(doKin=doKin,seqf=seqf,exprf=exprf,outfnkin=kinf,outPedFile=outPedFile,outMapFile=outMapFile,kkin=kkin,kmotif=kmotif,frac=frac,useFast=useFast)
File "/mnt/fls01-home01/mqbpwlc2/privatemodules/MixMir/parseAll.py", line 76, in doAll
makePed(genes=genes,dcounts=dcounts,dexprs=dexprs,outfn=outPedFile)
File "/mnt/fls01-home01/mqbpwlc2/privatemodules/MixMir/parseAll.py", line 281, in makePed
newrow = [g,dexprs[g]] + map(isZero,dcounts[g])
TypeError: can only concatenate list (not "map") to list

python --version
Python 3.7.3

Hi,
I am trying to run mirmix on a list, rather small, of 3'UTR from the gene eve in different insects species. However I keep getting the same error and I cannot figure out what's the problem.

My fasta file looks like :

apis_mellifera_eve
GAA....
bombyx_mori_eve
TTTAGTT..
drosophila_melanogaster_eve
GCCCGCGA..
(total of 9 different sequences in FASTA format)

My ID ranked files looks like (rank is arbitrary and was created by myself) :
apis_mellifera_eve 3
bombyx_mori_eve -2
drosophila_melanogaster_eve 4
drosophila_sechillia_eve 4
drosophila_simulans_eve 4
drosophila_yakuba_eve 4
oncopeltus_fasciatus_eve -3
nasonia_vitripennis_eve -1
tribolium_castaneum_eve -2
(total of 9 different UTRs)

I am using microRNA mature sequences downloaded from mirbase:

dps-miR-2517a-3p
UAUUG..
dps-miR-2543a-5p
AUCCUAU..
dps-miR-2543a-3p
UAUGCA..
dps-miR-2543b-5p
AUCCUA..

my command is : MixMir-master llilians$ python MixMir.py --seqf all_utr3p.fa --exprf IDs_ranked.txt --mirf arthropods-mature.fa --k_kin 6 --k_motif 6 --N 20 --fast 0 --out results

Error : Solving MLM with GEMMA
Parsing files for PLINK
Traceback (most recent call last):
File "MixMir.py", line 157, in
doAll(doKin=doKin)
File "MixMir.py", line 18, in doAll
runParse(doKin=doKin)
File "MixMir.py", line 43, in runParse
parseAll.doAll(doKin=doKin,seqf=seqf,exprf=exprf,outfnkin=kinf,outPedFile=outPedFile,outMapFile=outMapFile,kkin=kkin,kmotif=kmotif,frac=frac,useFast=useFast)
File "/Users/llilians/Desktop/MixMir-master/parseAll.py", line 46, in doAll
exprs = loadmic(fname=exprf)
File "/Users/llilians/Desktop/MixMir-master/parseAll.py", line 112, in loadmic
exprs = [[row[0],float(row[1])] for row in exprs]
File "/Users/llilians/Desktop/MixMir-master/parseAll.py", line 112, in
exprs = [[row[0],float(row[1])] for row in exprs]
IndexError: list index out of range

Could you please help me to figure out what's the problem here ?
Thanks,

Hi,
I'm trying to use MixMir on mac OS v10.15.5. Because of this I've had to download newer versions of PLINK and GEMMA than you recommend in the README.txt (not sure whether this is what's causing the issue).

When I try and run the test data I receive this error:

/usr/bin/python2.7 /Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/command_line_test.py
Solving MLM with GEMMA
Parsing files for PLINK
Removing 418 motifs with no information
Removing 418 motifs with no information
Finished parsing files!
Running PLINK...........................
PLINK v1.90p 64-bit (16 Jun 2020) www.cog-genomics.org/plink/1.9/
(C) 2005-2020 Shaun Purcell, Christopher Chang GNU General Public License v3
Logging to /Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test.log.
Options in effect:
--file /Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test
--make-bed
--map3
--no-fid
--no-parents
--no-sex
--noweb
--out /Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test

Note: --map3 flag unnecessary (.map file format is autodetected).
Note: --noweb has no effect since no web check is implemented yet.
16384 MB RAM detected; reserving 8192 MB for main workspace.
.ped scan complete (for binary autoconversion).
Performing single-pass .bed write (3678 variants, 24 people).
--file:
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test-temporary.bed
+
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test-temporary.bim
+
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test-temporary.fam
written.
3678 variants loaded from .bim file.
24 people (0 males, 0 females, 24 ambiguous) loaded from .fam.
Ambiguous sex IDs written to
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test.nosex
.
24 phenotype values loaded from .fam.
Using 1 thread (no multithreaded calculations invoked).
Before main variant filters, 24 founders and 0 nonfounders present.
Calculating allele frequencies... done.
3678 variants and 24 people pass filters and QC.
Phenotype data is quantitative.
--make-bed to
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test.bed
+
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test.bim
+
/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/testdat/test.fam
... done.
PLINK files generated!
Solving MLM.................
GEMMA 0.97 (2017/12/20) by Xiang Zhou and team (C) 2012-2017
Reading Files ...

number of total individuals = 24

number of analyzed individuals = 24

number of covariates = 1

number of phenotypes = 1

number of total SNPs/var = 3678

number of analyzed SNPs = 3678

Start Eigen-Decomposition...
**** WARNING: K has 4 eigenvalues close to zero in src/gemma.cpp at line 2563
**** WARNING: K is ill conditioned! in src/gemma.cpp at line 2563
**** WARNING: K has more than one negative eigenvalues! in src/gemma.cpp at line 2563
**** WARNING: K is not positive definite! in src/gemma.cpp at line 2563 in BatchRun
**** WARNING: Matrix G has 4 eigenvalues close to zero
GEMMA 0.97 (2017/12/20) by Xiang Zhou and team (C) 2012-2017
Reading Files ...

number of total individuals = 24

number of analyzed individuals = 24

number of covariates = 1

number of phenotypes = 1

number of total SNPs/var = 3678

number of analyzed SNPs = 3678

pve estimate =0.999988
se(pve) =9.6319e-06
================================================== 100%
MLM solve complete!
Analyzing results.......................
Traceback (most recent call last):
File "/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/MixMir.py", line 157, in
doAll(doKin=doKin)
File "/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/MixMir.py", line 31, in doAll
getResults()
File "/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/MixMir.py", line 89, in getResults
analyze.doAll(resFile=resFile,mirFile=mirf,seqFile=seqf,N=Nkeep,useFast=useFast,outfn=resf)
File "/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/analyze.py", line 34, in doAll
res = loadGemmaRes(f=resFile,reverse=True)
File "/Users/user/Dropbox/PhD/3rd_year/python_scripts/MixMir-master/analyze.py", line 147, in loadGemmaRes
gem = [[revcomp(row[1]),float(row[-1]),float(row[4])] for row in gem]
ValueError: could not convert string to float: A

Is there anyway I can solve this issue? Thanks!