GithubHelp home page GithubHelp logo

genome.fa problem about edta HOT 7 CLOSED

xiaomifeng12 avatar xiaomifeng12 commented on June 12, 2024
genome.fa problem

from edta.

Comments (7)

oushujun avatar oushujun commented on June 12, 2024

from edta.

xiaomifeng12 avatar xiaomifeng12 commented on June 12, 2024

Thank you very much for your reply.

Missing “>” of the sequence ID in pasting.
This is the animal genome, with a genome size of 1.5G.
I tried reinstalling the EDTA software using conda.
I tried starting the sequence id with a letter and then running the command. But the errors are still reported, and the "*TIR.intact.fa" file and "*TIR.intact.fa" file in the "*mod.EDTA.raw" folder are empty.
Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1

Results
less /genome.fasta.mod.EDTA.raw/genome.fasta.mod.TIR.intact.fa
less /genome.fasta.mod.EDTA.raw/genome.fasta.mod.Helitron.intact.fa

  1. These files (genome.fasta.mod.TIR.intact.fa, genome.fasta.mod.Helitron.intact.gff3, genome.fasta.mod.Helitron.intact.fa,genome.fasta.mod.TIR.intact.gff3) are empty.
  2. These "genome.fasta.mod.EDTA.intact.fa" and "genome.fasta.mod.EDTA.intact.gff3" files are not generated in "genome.fasta.mod.EDTA.raw" folder.

errors
error1
Sun Oct 8 00:30:29 CST 2023 EDTA_raw: Check dependencies, prepare working directories.
Sun Oct 8 00:30:30 CST 2023 Start to find LTR candidates.
Sun Oct 8 00:30:30 CST 2023 Identify LTR retrotransposon candidates from scratch.
Sun Oct 8 00:31:06 CST 2023 Finish finding LTR candidates.
Sun Oct 8 00:31:06 CST 2023 Start to find TIR candidates.
Sun Oct 8 00:31:06 CST 2023 Identify TIR candidates from scratch.
Species: others
Sun Oct 8 00:31:46 CST 2023 Finish finding TIR candidates.
Sun Oct 8 00:31:46 CST 2023 Start to find Helitron candidates.
Sun Oct 8 00:31:46 CST 2023 Identify Helitron candidates from scratch.
Warning: LOC list genome.fasta.mod.HelitronScanner.raw.ext.list is empty.
Warning: LOC list genome.fasta.mod.HelitronScanner.raw.ext.list is empty.
Error: Error while loading sequence
perl make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed
Sun Oct 8 00:32:14 CST 2023 Warning: The Helitron result file has 0 bp!
Sun Oct 8 00:32:14 CST 2023 Execution of EDTA_raw.pl is finished!
ERROR: Raw Helitron results not found in genome.fasta.mod.EDTA.raw/genome.fasta.mod.Helitron.raw.fa
If you believe the program is working properly, this may be caused by the lack of intact Helitrons in your genome. Consider to use the --force 1 parameter to overwrite this check

error2
Species: others
Traceback (most recent call last):
File "/public/home/ddd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/Process
pool = multiprocessing.Pool(int(t))
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/context.py", li
context=self.get_context())
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/pool.py", line
self._repopulate_pool()
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/pool.py", line
w.start()
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/process.py", li
self._popen = self._Popen(self)
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/context.py", li
return Popen(process_obj)
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/popen_fork.py",
self._launch(process_obj)
File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/popen_fork.py",
self.pid = os.fork()
OSError: [Errno 12] Cannot allocate memory
cp: cannot stat 'TIR-Learner/-p': No such file or directory
cat: '
-+-DTA.fa': No such file or directory
cat: '-+-DTC.fa': No such file or directory
cat: '
-+-DTH.fa': No such file or directory
cat: '-+-DTM.fa': No such file or directory
cat: '
-+-DTT.fa': No such file or directory
cat: '-+-NonTIR.fa': No such file or directory
cat: '
-+--+-.gff3': No such file or directory
rm: cannot remove '-+--+-*.gff3': No such file or directory
Traceback (most recent call last):

This file1 only contains one sequence for testing. This is my file1 format.

>Chr5
TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT
TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA
TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT
GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT
AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG
ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT

This file2 only contains one sequence for testing. This is my file2 format.

>ct002.1
aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag
atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa
aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac
cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga
atagtttccgagttattaaggtttgaagttttgacttcaaggggagataactcaagaaag
aagtcgaaaatcaaaaaaagtggctcgttattatcttagttcagccacaggctagcatcc
ctgcaaatgtcatgcaaatcggcccagtggttacttcagaaacctctggtcaaaaaagta

Looking forward to your reply. Thank you very much!

Try not to use number only sequence names. Your two files do not follow the FASTA format conventions, which require each sequence ID starts with “>” Shujun

On Sat, Oct 7, 2023 at 2:09 PM xiaomifeng12 @.> wrote: Dear @oushujun https://github.com/oushujun Many thanks for developing this very useful tool. Some errors occurred while using EDTA software I installed the EDTA software using Conda and ran the data in test using the EDTA command, and everything went smoothly. conda activate EDTA Usage: EDTA.pl --genome test.genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1 But when using the same EDTA command to run my data, some errors will be reported. conda activate EDTA Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1 error1: Species: others Traceback (most recent call last): File "/public/home/dd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/RunGRF.py", line 79, in if (len(str(records[0].seq))>int(length)+500): IndexError: list index out of range cp: cannot stat 'TIR-Learner/-p': No such file or directorycat: '-+-DTA.fa': No such file or directory cat: '-+-DTC.fa': No such file or directorycat: '-+-DTH.fa': No such file or directory cat: '-+-DTM.fa': No such file or directorycat: '-+-DTT.fa': No such file or directory cat: '-+-NonTIR.fa': No such file or directorycat: '-+--+-.gff3': No such file or directory rm: cannot remove '-+--+-.gff3': No such file or directory Traceback (most recent call last): error2: Species: others Warning: LOC list Cjam.genome.fasta.mod.TIR.ext30.list is empty. Error: Error while loading sequenceWarning: The TIR result file has 0 bp! Sun Oct 8 00:01:27 CST 2023 Start to find Helitron candidates. Sun Oct 8 00:01:27 CST 2023 Identify Helitron candidates from scratch. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Error: Error while loading sequence perl make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed This is my file1 format 010000002.1 aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga This is my file2 format Chr5 TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT GTTTGGTATCGTTTTAGTATTCCTCCAGTCAGCTCAGCCATGTCTGATTCTGTTAGCGTT CTGATTCTGTTAGTATTGTCATTTTGCGAATGCAGTGAGATTTGGAGACGGTTAAACTCA GTATCGATAAGAATATTATATTTCCCGGAAAGAACATATTTGAGAAAGACGGAAATTTCA GACTGCTTTTCTGTGCCAAAAGGTGTCTCCAGCACAAGGACTGTTCGTTCATCACACGAA ACCGGGAATGTCGAGGATTCGGTAACTCGGAAGGAATTGAAATATATATGCTATATCTTT I have tried various parameters, but still cannot run EDTA normally. I hope you can help solve it. Thank you very much! — Reply to this email directly, view it on GitHub <#393>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNX4NBDZFXQCPDSHI2XDC3X6GLD7AVCNFSM6AAAAAA5XCSVIOVHI2DSMVQWIX3LMV43ASLTON2WKOZRHEZTCNBUHA3DINQ . You are receiving this because you were mentioned.Message ID: @.*>

from edta.

oushujun avatar oushujun commented on June 12, 2024

from edta.

xiaomifeng12 avatar xiaomifeng12 commented on June 12, 2024

Thank you very much for your reply.

I reinstalled the EDTA using conda and ran the data in test file using the EDTA command, and everything went smoothly.

Steps for installing EDTA:

git clone https://github.com/oushujun/EDTA.git
conda env create -f EDTA.yml

Run data in test file using EDTA, and the results are normal without any errors.

EDTA.pl --genome test.genome.fasta --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.2e-9 --curatedlib sine_line_base.fa --overwrite 1

Running my data using EDTA, some errors occurred. These errors are what I mentioned above

EDTA.pl --genome genome.fasta --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.2e-9 --curatedlib sine_line_base.fa --overwrite 1

This file1 only contains one sequence (~20M) for testing. This is my file1 format.

>Chr5
TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT
TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA
TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT
GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT
AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG
ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT

This file2 only contains one sequence for testing. This is my file2 format.

>ct002.1
aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag
atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa
aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac
cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga
atagtttccgagttattaaggtttgaagttttgacttcaaggggagataactcaagaaag
aagtcgaaaatcaaaaaaagtggctcgttattatcttagttcagccacaggctagcatcc
ctgcaaatgtcatgcaaatcggcccagtggttacttcagaaacctctggtcaaaaaagta

Looking forward to your reply. Thank you very much!

Try the test file. Looks like not installed correctly. Try to install with the yml file. Shujun On Mon, Oct 9, 2023 at 5:10 AM xiaomifeng12 @.> wrote:

Thank you very much for your reply. Missing “>” of the sequence ID in pasting. This is the animal genome, with a genome size of 1.5G. I tried reinstalling the EDTA software using conda. I tried starting the sequence id with a letter and then running the command. But the errors are still reported, and the "TIR.intact.fa" file and "TIR.intact.fa" file in the "mod.EDTA.raw" folder are empty. Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1 Results less /genome.fasta.mod.EDTA.raw/genome.fasta.mod.TIR.intact.fa less /genome.fasta.mod.EDTA.raw/genome.fasta.mod.Helitron.intact.fa 1. These files (genome.fasta.mod.TIR.intact.fa, genome.fasta.mod.Helitron.intact.gff3, genome.fasta.mod.Helitron.intact.fa,genome.fasta.mod.TIR.intact.gff3) are empty. 2. These "genome.fasta.mod.EDTA.intact.fa" and "genome.fasta.mod.EDTA.intact.gff3" files are not generated in "genome.fasta.mod.EDTA.raw" folder. errors error1 Sun Oct 8 00:30:29 CST 2023 EDTA_raw: Check dependencies, prepare working directories. Sun Oct 8 00:30:30 CST 2023 Start to find LTR candidates. Sun Oct 8 00:30:30 CST 2023 Identify LTR retrotransposon candidates from scratch. Sun Oct 8 00:31:06 CST 2023 Finish finding LTR candidates. Sun Oct 8 00:31:06 CST 2023 Start to find TIR candidates. Sun Oct 8 00:31:06 CST 2023 Identify TIR candidates from scratch. Species: others Sun Oct 8 00:31:46 CST 2023 Finish finding TIR candidates. Sun Oct 8 00:31:46 CST 2023 Start to find Helitron candidates. Sun Oct 8 00:31:46 CST 2023 Identify Helitron candidates from scratch. Warning: LOC list genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Warning: LOC list genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Error: Error while loading sequence perl make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed Sun Oct 8 00:32:14 CST 2023 Warning: The Helitron result file has 0 bp! Sun Oct 8 00:32:14 CST 2023 Execution of EDTA_raw.pl is finished! ERROR: Raw Helitron results not found in genome.fasta.mod.EDTA.raw/genome.fasta.mod.Helitron.raw.fa If you believe the program is working properly, this may be caused by the lack of intact Helitrons in your genome. Consider to use the --force 1 parameter to overwrite this check error2 Species: others Traceback (most recent call last): File "/public/home/ddd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/Process pool = multiprocessing.Pool(int(t)) File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/context.py", li context=self.get_context()) File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/pool.py", line self._repopulate_pool() File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/pool.py", line w.start() File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/process.py", li self._popen = self._Popen(self) File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/context.py", li return Popen(process_obj) File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/popen_fork.py", self._launch(process_obj) File "/public/home/ddd/miniconda3/envs/EDTA/lib/python3.6/multiprocessing/popen_fork.py", self.pid = os.fork() OSError: [Errno 12] Cannot allocate memory cp: cannot stat 'TIR-Learner/ -p': No such file or directory cat: '-+-DTA.fa': No such file or directory cat: ' -+-DTC.fa': No such file or directory cat: '-+-DTH.fa': No such file or directory cat: ' -+-DTM.fa': No such file or directory cat: '-+-DTT.fa': No such file or directory cat: ' -+-NonTIR.fa': No such file or directory cat: '-+--+-.gff3': No such file or directory rm: cannot remove '-+-
-+-
.gff3': No such file or directory Traceback (most recent call last): This file1 only contains one sequence for testing. This is my file1 format. >Chr5 TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT This file2 only contains one sequence for testing. This is my file2 format. >ct002.1 aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga atagtttccgagttattaaggtttgaagttttgacttcaaggggagataactcaagaaag aagtcgaaaatcaaaaaaagtggctcgttattatcttagttcagccacaggctagcatcc ctgcaaatgtcatgcaaatcggcccagtggttacttcagaaacctctggtcaaaaaagta Looking forward to your reply. Thank you very much! Try not to use number only sequence names. Your two files do not follow the FASTA format conventions, which require each sequence ID starts with “>” Shujun … <#m_-5305312461138073466_> On Sat, Oct 7, 2023 at 2:09 PM xiaomifeng12 @.
> wrote: Dear @oushujun https://github.com/oushujun https://github.com/oushujun https://github.com/oushujun Many thanks for developing this very useful tool. Some errors occurred while using EDTA software I installed the EDTA software using Conda and ran the data in test using the EDTA command, and everything went smoothly. conda activate EDTA Usage: EDTA.pl --genome test.genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1 But when using the same EDTA command to run my data, some errors will be reported. conda activate EDTA Usage: EDTA.pl --genome genome.fa --step all --species others --sensitive 1 --anno 1 --threads 32 --u 1.6e-8 --curatedlib ~/db/sine_line.fa --overwrite 1 error1: Species: others Traceback (most recent call last): File "/public/home/dd/miniconda3/envs/EDTA/share/EDTA/bin/TIR-Learner2.5/Module2/RunGRF.py", line 79, in if (len(str(records[0].seq))>int(length)+500): IndexError: list index out of range cp: cannot stat 'TIR-Learner/-p': No such file or directorycat: '-+-DTA.fa': No such file or directory cat: '-+-DTC.fa': No such file or directorycat: '-+-DTH.fa': No such file or directory cat: '-+-DTM.fa': No such file or directorycat: '-+-DTT.fa': No such file or directory cat: '-+-NonTIR.fa': No such file or directorycat: '-+--+-.gff3': No such file or directory rm: cannot remove '-+--+-.gff3': No such file or directory Traceback (most recent call last): error2: Species: others Warning: LOC list Cjam.genome.fasta.mod.TIR.ext30.list is empty. Error: Error while loading sequenceWarning: The TIR result file has 0 bp! Sun Oct 8 00:01:27 CST 2023 Start to find Helitron candidates. Sun Oct 8 00:01:27 CST 2023 Identify Helitron candidates from scratch. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Warning: LOC list Cjam.genome.fasta.mod.HelitronScanner.raw.ext.list is empty. Error: Error while loading sequence perl make_bed_with_intact.pl http://make_bed_with_intact.pl EDTA.intact.fa > EDTA.intact.bed This is my file1 format 010000002.1 aatcctcttactaatgtatttatcttcaaaataagctatcacatgtagctatagtcatag atttgagggaggagaagattttcttagacgcgtaccccaaaaaccgcgtaagttcacaaa aaatcagttttttcgaaatagcaacaaatctattgttccggcagaaaaaaggccgtcaac cttttcgatggggaatgtttttgcgcacattttggtgaaaatgttgtgaaaatatcttga This is my file2 format Chr5 TAAAATACCTAACATGCTTTAAGTTTTCAATATTTCGTTGAAATTAATCAAGTTTCTTAT TTTTATTTTTGCAACTTAATTTGATACATGTTTTGATAAGTTTTGAAAACGAAGTTTAAA TAATTAATATGGAATTTTTCCTTTCTGCCAAATAATGTGGGTATGTCAACGAAACCCTAT GACAGAACTCATAACCGTCAGTTTGACAGGCGGTATAAGTCTCTCCACTGACATCCACTT AAATGTTTGATATGGTTTTTGTAGTAGTCCATTGTGGAAAAAATATTTATTTCCTCTTTG ACCATTTTTTTCTACAGGTATAACTCATGTAAACTTTAACAAAACAAATACTTGCTTCGT GTTTGGTATCGTTTTAGTATTCCTCCAGTCAGCTCAGCCATGTCTGATTCTGTTAGCGTT CTGATTCTGTTAGTATTGTCATTTTGCGAATGCAGTGAGATTTGGAGACGGTTAAACTCA GTATCGATAAGAATATTATATTTCCCGGAAAGAACATATTTGAGAAAGACGGAAATTTCA GACTGCTTTTCTGTGCCAAAAGGTGTCTCCAGCACAAGGACTGTTCGTTCATCACACGAA ACCGGGAATGTCGAGGATTCGGTAACTCGGAAGGAATTGAAATATATATGCTATATCTTT I have tried various parameters, but still cannot run EDTA normally. I hope you can help solve it. Thank you very much! — Reply to this email directly, view it on GitHub <#393 <#393>>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNX4NBDZFXQCPDSHI2XDC3X6GLD7AVCNFSM6AAAAAA5XCSVIOVHI2DSMVQWIX3LMV43ASLTON2WKOZRHEZTCNBUHA3DINQ https://github.com/notifications/unsubscribe-auth/ABNX4NBDZFXQCPDSHI2XDC3X6GLD7AVCNFSM6AAAAAA5XCSVIOVHI2DSMVQWIX3LMV43ASLTON2WKOZRHEZTCNBUHA3DINQ . You are receiving this because you were mentioned.Message ID: @.> — Reply to this email directly, view it on GitHub <#393 (comment)>, or unsubscribe https://github.com/notifications/unsubscribe-auth/ABNX4NEJCJ3RY4Q4XRKRKXTX6O5QDAVCNFSM6AAAAAA5XCSVIOVHI2DSMVQWIX3LMV43OSLTON2WKQ3PNVWWK3TUHMYTONJSGYYTGNBYGA . You are receiving this because you were mentioned.Message ID: @.*>

from edta.

oushujun avatar oushujun commented on June 12, 2024

from edta.

oushujun avatar oushujun commented on June 12, 2024

@xiaomifeng12 any luck?

from edta.

oushujun avatar oushujun commented on June 12, 2024

Inactive, closing for now. Please reopen if the issue persists.

from edta.

Related Issues (20)

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.