pkerpedjiev / bwa-pssm Goto Github PK
View Code? Open in Web Editor NEWA burrows-wheeler transform-based probabilistic short read mapper.
License: GNU General Public License v3.0
A burrows-wheeler transform-based probabilistic short read mapper.
License: GNU General Public License v3.0
Hi, I've been trying to run bwa-pssm on a set of artificially generated reads but the following pair causes a seg fault:
==> debug2_s1.fq <==
@r26223_from_NC_000913_h10_ids100-h0 ln302#0/1
ACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCC
+
=GI:IHII@IIGI@IIBFIIIIIIIIIBHIIIGHBIIIIIIIIIIG:AGIAHHIHDB<DI#IEFG>CBGG<HE#DC??D#
==> debug2_s2.fq <==
@r26223_from_NC_000913_h10_ids100-h0 ln302#0/2
CCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGC
+
FHFHFIIIHIDIIIIIIGF@IIH<IBIGHHIIIGHII4IE8G9IGIIFBDCIIDDADHEIDIGFHHI;GGGBACEBGG@;EHDA@E#DBCH###@#=#BI
bwa pssm seems to run just fine, but then the output of the sampe step is as follows:
@sq SN:NC_000913 LN:4639675
@pg ID:bwa PN:bwa VN:0.6.0-r70-dev
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_sai2sam_pe_core] convert to sequence coordinate...
[infer_isize] fail to infer insert size: too few good pairs
[bwa_sai2sam_pe_core] time elapses: 0.00 sec
[bwa_sai2sam_pe_core] changing coordinates of 0 alignments.
[bwa_sai2sam_pe_core] align unmapped mate...
[bwa_sai2sam_pe_core] time elapses: 0.00 sec
[bwa_sai2sam_pe_core] refine gapped alignments... 0.00 sec
[bwa_sai2sam_pe_core] print alignments... r26223_from_NC_000913_h10_ids100-h0 83 NC_00091 3760790 0 100M = 3760588 -302 GGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGT #D??CD#EHGFEI#IDFIGHHIFGCEIIIHDBII<:GIIIIIIIIIIBHGIIIHBIIIIIIIIIFBII@IGII@IIHI:IG= XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100 PS:f:195.145996 NB:i:3 PP:f:0.333333 XA:Z:NC_000913,-729390,100M,0;NC_000913,-3760790,100M,0;NC_000913,-3617799,100M,0; XS:A:0.000000;0.000000;0.000000;
r26223_from_NC_000913_h10_ids100-h0 163 NC_000913 3760588 0 100M = 3760790 302 CCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGC FHFHFIIIHIDIIIIIIGF@IIH<IBIGHHIIIGHII4IE8G9IGIIFBDCIIDDADHEIDIGFHHI;GGGBACEBGG@;EHDA@E#DBCH###@#=#BI XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100 PS:f:192.384003 NB:i:3 PP:f:0.333333 XA:Z:NC_000913,+729188,100M,0;NC_000913,+3617597,100M,0;NC_000913,+3760588,100M,0; XS:A:0.000000;0.000000;0.000000;
0.00 sec
Segmentation fault (core dumped)
--while running it with valgrind gives the following output:
==5709== Invalid free() / delete / delete[]
==5709== at 0x4A0595D: free (vg_replace_malloc.c:366)
==5709== by 0x418DCA: bwa_free_read_seq (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424B16: bwa_sai2sam_pe_core (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424FE6: bwa_sai2sam_pe (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x3BCB21ECDC: (below main) (in /lib64/libc-2.12.so)
==5709== Address 0x396295 is not stack'd, malloc'd or (recently) free'd
==5709==
==5709== Invalid free() / delete / delete[]
==5709== at 0x4A0595D: free (vg_replace_malloc.c:366)
==5709== by 0x418DCA: bwa_free_read_seq (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424B2A: bwa_sai2sam_pe_core (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424FE6: bwa_sai2sam_pe (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x3BCB21ECDC: (below main) (in /lib64/libc-2.12.so)
==5709== Address 0x37333c is not stack'd, malloc'd or (recently) free'd
I'd appreciate any help on this. Thanks!
http://home.gna.org/gdsl/ seems to be down forever now. Do you know a new way to get the dependencies?
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.