GithubHelp home page GithubHelp logo

pkerpedjiev / bwa-pssm Goto Github PK

View Code? Open in Web Editor NEW
10.0 10.0 6.0 1.07 MB

A burrows-wheeler transform-based probabilistic short read mapper.

License: GNU General Public License v3.0

C 89.45% C++ 2.77% Perl 2.21% Python 1.62% Makefile 0.44% Groff 3.52%

bwa-pssm's People

Contributors

bpow avatar jmarshall avatar lh3 avatar pkerpedjiev avatar roelkluin avatar sjackman avatar sorensjm avatar

Stargazers

 avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar  avatar

Watchers

 avatar  avatar  avatar

bwa-pssm's Issues

Truncated sampe output / Segmentation fault

Hi, I've been trying to run bwa-pssm on a set of artificially generated reads but the following pair causes a seg fault:

==> debug2_s1.fq <==
@r26223_from_NC_000913_h10_ids100-h0 ln302#0/1
ACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCC
+
=GI:IHII@IIGI@IIBFIIIIIIIIIBHIIIGHBIIIIIIIIIIG:AGIAHHIHDB<DI#IEFG>CBGG<HE#DC??D#

==> debug2_s2.fq <==
@r26223_from_NC_000913_h10_ids100-h0 ln302#0/2
CCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGC
+
FHFHFIIIHIDIIIIIIGF@IIH<IBIGHHIIIGHII4IE8G9IGIIFBDCIIDDADHEIDIGFHHI;GGGBACEBGG@;EHDA@E#DBCH###@#=#BI

bwa pssm seems to run just fine, but then the output of the sampe step is as follows:

@sq SN:NC_000913 LN:4639675
@pg ID:bwa PN:bwa VN:0.6.0-r70-dev
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_read_seq] 0.0% bases are trimmed.
[bwa_sai2sam_pe_core] convert to sequence coordinate...
[infer_isize] fail to infer insert size: too few good pairs
[bwa_sai2sam_pe_core] time elapses: 0.00 sec
[bwa_sai2sam_pe_core] changing coordinates of 0 alignments.
[bwa_sai2sam_pe_core] align unmapped mate...
[bwa_sai2sam_pe_core] time elapses: 0.00 sec
[bwa_sai2sam_pe_core] refine gapped alignments... 0.00 sec
[bwa_sai2sam_pe_core] print alignments... r26223_from_NC_000913_h10_ids100-h0 83 NC_00091 3760790 0 100M = 3760588 -302 GGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGT #D??CD#EHGFEI#IDFIGHHIFGCEIIIHDBII<:GIIIIIIIIIIBHGIIIHBIIIIIIIIIFBII@IGII@IIHI:IG= XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100 PS:f:195.145996 NB:i:3 PP:f:0.333333 XA:Z:NC_000913,-729390,100M,0;NC_000913,-3760790,100M,0;NC_000913,-3617799,100M,0; XS:A:0.000000;0.000000;0.000000;
r26223_from_NC_000913_h10_ids100-h0 163 NC_000913 3760588 0 100M = 3760790 302 CCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGC FHFHFIIIHIDIIIIIIGF@IIH<IBIGHHIIIGHII4IE8G9IGIIFBDCIIDDADHEIDIGFHHI;GGGBACEBGG@;EHDA@E#DBCH###@#=#BI XT:A:R NM:i:0 SM:i:0 AM:i:0 X0:i:3 X1:i:0 XM:i:0 XO:i:0 XG:i:0 MD:Z:100 PS:f:192.384003 NB:i:3 PP:f:0.333333 XA:Z:NC_000913,+729188,100M,0;NC_000913,+3617597,100M,0;NC_000913,+3760588,100M,0; XS:A:0.000000;0.000000;0.000000;
0.00 sec
Segmentation fault (core dumped)

--while running it with valgrind gives the following output:
==5709== Invalid free() / delete / delete[]
==5709== at 0x4A0595D: free (vg_replace_malloc.c:366)
==5709== by 0x418DCA: bwa_free_read_seq (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424B16: bwa_sai2sam_pe_core (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424FE6: bwa_sai2sam_pe (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x3BCB21ECDC: (below main) (in /lib64/libc-2.12.so)
==5709== Address 0x396295 is not stack'd, malloc'd or (recently) free'd
==5709==
==5709== Invalid free() / delete / delete[]
==5709== at 0x4A0595D: free (vg_replace_malloc.c:366)
==5709== by 0x418DCA: bwa_free_read_seq (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424B2A: bwa_sai2sam_pe_core (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x424FE6: bwa_sai2sam_pe (in /home/wilma/local/src/bwa-pssm/bwa-pssm-v0.4)
==5709== by 0x3BCB21ECDC: (below main) (in /lib64/libc-2.12.so)
==5709== Address 0x37333c is not stack'd, malloc'd or (recently) free'd

I'd appreciate any help on this. Thanks!

  • Grace

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    ๐Ÿ–– Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. ๐Ÿ“Š๐Ÿ“ˆ๐ŸŽ‰

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google โค๏ธ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.