GithubHelp home page GithubHelp logo

sunnyisgalaxy / moabs Goto Github PK

View Code? Open in Web Editor NEW
14.0 14.0 10.0 49.2 MB

A comprehensive, accurate and efficient solution for analysis of large scale base-resolution DNA methylation data

Perl 2.21% Shell 0.01% Makefile 0.17% C++ 84.53% C 11.66% HTML 0.06% Python 0.07% TeX 0.05% Java 0.08% Lua 0.27% CMake 0.17% Roff 0.65% M4 0.02% R 0.05%

moabs's People

Contributors

biocoder avatar dangertrip avatar lijinbio avatar sunnyisgalaxy avatar

Stargazers

avatar avatar avatar avatar avatar avatar avatar avatar avatar avatar avatar

Watchers

avatar avatar avatar avatar

Forkers

afirth meissnerlab karl616 ktang lijinbio mtzhang1991 dangertrip biobai

moabs's Issues

mcall crashes on overlapClip BAM files (bamutils)

HI,

I am using mcall on bsmaped WGBS data which has been overlap-clipped by bamutils overlapClip[1]. mcall crashes on data with a core cump :

strace:

[...]
[pid 29925] read(3, "CC\nGAGCAGGTTGCCCATTGAAGAGGCGGCGG"..., 8191) = 8191
[pid 29925] read(3, "TGCTGTTCTTAGAGACTGAACA\nATTAAAATA"..., 8191) = 8191
[pid 29925] read(3, "gcttaaaaagaaaaaggaaaaagaagacacag"..., 8191) = 8191
[pid 29925] read(3, "atggctgagaa\ngcacctgaaaaaaagtgttc"..., 8191) = 8191
[pid 29925] read(3, "aaggtagaaataacccaagggtcactcaacc\n"..., 8191) = 8191
[pid 29925] read(3, "\ncccacccacccccactcccctacccacccac"..., 8191) = 8191
[pid 29925] read(3, "tctcttagaatctgcatgac\nctctgaccagg"..., 8191) = 8191
[pid 29925] read(3, "ttctgtcgcacaaattatagtctttcatgaag"..., 8191) = 8191
[pid 29925] read(3, "atcttggca\nccctcttctggtgtgcaggcag"..., 8191) = 8191
[pid 29925] read(3, "CTGTAAAACACCCCACAGATAAGTAATGT\nGC"..., 8191) = 8191
[pid 29925] read(3, "ggcgtggcagaacgaatgagcaggaagctcca"..., 8191) = 5411
[pid 29925] read(3, "", 8191)           = 0
[pid 29925] close(3)                    = 0
[pid 29925] mmap(NULL, 8392704, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS|MAP_STACK, -1, 0) = 0x7fce847f1000
[pid 29925] mprotect(0x7fce847f1000, 4096, PROT_NONE) = 0
[pid 29925] clone(strace: Process 29951 attached
child_stack=0x7fce84ff0e70, flags=CLONE_VM|CLONE_FS|CLONE_FILES|CLONE_SIGHAND|CLONE_THREAD|CLONE_SYSVSEM|CLONE_SETTLS|CLONE_PARENT_SETTID|CLONE_CHILD_CLEARTID, parent_tidptr=0x7fce84ff19d0, tls=0x7fce84ff1700, child_tidptr=0x7fce84ff19d0) = 29951
[pid 29951] set_robust_list(0x7fce84ff19e0, 24 <unfinished ...>
[pid 29925] futex(0x7fce94010f34, FUTEX_WAIT_PRIVATE, 1, NULL <unfinished ...>
[pid 29951] <... set_robust_list resumed> ) = 0
[pid 29951] write(1, "Start processing file AM-WGBS-00"..., 72Start processing file MYSAMPLE_3m_test.srt.oc.rdp.bam on chrom chr10
) = 72
[pid 29951] open("MYSAMPLE_3m_test.srt.oc.rdp.bam.chr10_skip.bed", O_WRONLY|O_CREAT|O_TRUNC, 0666) = 3
[pid 29951] write(3, "#chrom\tstart\tend\tratio\ttotalC\tme"..., 48) = 48
[pid 29951] open("MYSAMPLE_3m_test.srt.oc.rdp.bam", O_RDONLY) = 4
[pid 29951] mprotect(0x7fce8c021000, 8192, PROT_READ|PROT_WRITE) = 0
[pid 29951] lseek(4, -28, SEEK_END)     = 599820951
[pid 29951] read(4, "\37\213\10\4\0\0\0\0\0\377\6\0BC\2\0\33\0\3\0\0\0\0\0\0\0\0\0", 28) = 28
[pid 29951] lseek(4, 0, SEEK_SET)       = 0
[pid 29951] read(4, "\37\213\10\4\0\0\0\0\0\377\6\0BC\2\0N3", 18) = 18
[pid 29951] read(4, "\325}k\214#\311}_\355\354\356\255Nc\301\2526\r\24\201\30`3;'&\213\336c7\337\355"..., 13117) = 13117
[pid 29951] mprotect(0x7fce8c023000, 8192, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c025000, 4096, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c026000, 4096, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c027000, 40960, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c031000, 40960, PROT_READ|PROT_WRITE) = 0
[pid 29951] futex(0x830090, FUTEX_WAKE_PRIVATE, 2147483647) = 0
[pid 29951] write(2, "terminate called after throwing "..., 48terminate called after throwing an instance of ') = 48
[pid 29951] write(2, "std::out_of_range", 17std::out_of_range) = 17
[pid 29951] write(2, "'\n", 2'
)          = 2
[pid 29951] write(2, "  what():  ", 11  what():  ) = 11
[pid 29951] write(2, "basic_string::substr", 20basic_string::substr) = 20
[pid 29951] write(2, "\n", 1
)           = 1
[pid 29951] rt_sigprocmask(SIG_UNBLOCK, [ABRT], NULL, 8) = 0
[pid 29951] tgkill(29916, 29951, SIGABRT) = 0
[pid 29951] --- SIGABRT {si_signo=SIGABRT, si_code=SI_TKILL, si_pid=29916, si_uid=184} ---
[pid 29916] <... futex resumed>)        = ?
[pid 29925] <... futex resumed>)        = ?
[pid 29925] +++ killed by SIGABRT (core dumped) +++
[pid 29951] +++ killed by SIGABRT (core dumped) +++
+++ killed by SIGABRT (core dumped) +++
Aborted (core dumped)

Any idea where to start looking for the problem?

Segmentation Faulting

Hello,
I am trying to run mcall module but segfaulting. I've tried to google/solve it myself, but I haven't had any success.

I am running a target position specific bisulfite sequencing (not WGBS, RRBS) following the programs method listed in a paper (Targeted bisulfite sequencing of the dynamic DNA methylome, Ziller et al. 2016). Essentially it's following Bismark -> Picard (dedup, sort) -> mcall

I've used a precompiled binary in the moabs-1.3.8.7 version and 1.3.8.6 but still, the same error.
Following is from stdout.

This is the command that I used.
mcall -m <bam> -r <hg38.fa>
*I've used one sample in this example, but running multiple samples still show the same error.

./moabs.sh /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
Options are saved in file run.config and printed here:
cytosineMinScore=20
excludedFlag=0
fullMode=0
keepTemp=0
mappedFiles=/data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
minFragSize=0
minMMFragSize=0
nextBaseMinScore=3
processPEOverlapSeq=1
qualityScoreBase=0
reference=/data/REFERENCE/hg38/hg38.fa
reportCHX=X
reportCpX=G
requiredFlag=0
skipRandomChrom=1
statsOnly=0
threads=1
trimRRBSEndRepairSeq=2
trimWGBSEndRepairPE1Seq=3
trimWGBSEndRepairPE2Seq=3
Program started
From the extension of file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam, program is parsing file according to BAM foramt
XR:Z or ZR:Z:, or ZS:Z: field not found, that is totally fine.
For file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam, the quality score format is Sanger format based at 33!
Protocol and read length are detected as WGBS and 151 bases for file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
For file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam the number of all reads is 17360352 and the number of mapped reads is 17360352
Start processing file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam on chrom chr1
./moabs.sh: line 9: 21517 Segmentation fault      $mcall -m $inbam -r $ref

Segmentation fault (core dumped)

I have 256G RAM on the system. I don't know why it is giving the Segmentation fault (core dumped) error. The alignment is from bismark and properly sorted.

mcall -m CDAA158_merged_final_sorted_dedup.deduplicated.bam -m CDAA328_merged_final_sorted_dedup.deduplicated.bam -m CDAA591_merged_final_sorted_dedup.deduplicated.bam -m CDAA94_merged_final_sorted_dedup.deduplicated.bam -p 2 --sampleName CDAA -r ${GENODIR}/hg38_r87.fa --skipRandomChrom 1

Output file is not under specified "--outputDir"

When I using mcall, I have specified the output director by using --outputDir. However, there is no output files under that direction. My pipeline is:

mcall -m input.bam --outputDir fullPathToOutputDir -g danRer11 --webOutputDir fullPathToWebOutputDir -r fullPathToFastaFile -a 1 -p 4

mcomp error calling --withVariance 1

@sunnyisgalaxy

I got this error while calling withVariance
Informational Message: The current Metropolis proposal is about to be rejected because of the following issue: stan::prob::beta_log: First shape parameter is inf, but must be finite! If this warning occurs sporadically, such as for highly constrained variable types like covariance matrices, then the sampler is fine, but if this warning occurs often then your model may be either severely ill-conditioned or misspecified.

Any idea?

Thanks

Looking for /pillar_storage/pillar00/deqiangs/ref/mm9.chrom.sizes, I am using human

@sunnyisgalaxy

How to pass the chromosome size file to mcomp, I have seen hard coded search for mm9 chromosome size in the log

Initial command:
mcomp -p 32 -c comp.UN.vs.TR.txt --doDmrScan=1 --doDmcScan=1 --dmrMethods=2 --minCredibleDif=0.1 --maxDistConsDmcs=300

Line from log:

running: egrep -v '^track|^browser|^#' dmc_M2_0_vs_1.bed > dmc_M2_0_vs_1.temp && bedToBigBed dmc_M2_0_vs_1.temp /pillar_storage/pillar00/deqiangs/ref/mm9.chrom.sizes dmc_M2_0_vs_1.bb && rm dmc_M2_0_vs_1.temp Couldn't open /pillar_storage/pillar00/deqiangs/ref/mm9.chrom.sizes

Thanks

buffer overflow when run bsmap

here is the screen output

[bsmap] @Thu Aug 15 16:07:40 2019 	loading reference file: /mnt/Storage/home/wangwen/source/bySpecies/hg38/hg38_main.fa 	(format: FASTA)
[bsmap] @Thu Aug 15 16:08:05 2019 	25 reference seqs loaded, total size 3088286401 bp. 25 secs passed
[bsmap] @Thu Aug 15 16:09:21 2019 	create seed table. 101 secs passed
[bsmap] @Thu Aug 15 16:09:21 2019 	Pair-end alignment(30 threads),
	Input read file #1: 5-meth-293-APODEC/293APODEC_BKDL190823184-1a_1.clean_val_1.fq.gz 	(format: gzipped FASTQ)
	Input read file #2: 5-meth-293-APODEC/293APODEC_BKDL190823184-1a_cut37_2.clean_val_2.fq.gz 	(format: gzipped FASTQ)
	Output file: 5-meth-293-APODEC/293_APOBEC.sam*** buffer overflow detected ***: bsmap terminated
======= Backtrace: =========
[0x523e62]
[0x523dbe]
[0x523679]
[0x4d3e0d]
[0x53c6bb]
[0x523711]
[0x52365d]
[0x4252a9]
[0x4020cd]
[0x4b8714]
[0x402fa1]
======= Memory map: ========
00400000-005ca000 r-xp 00000000 08:05 1308602                            /usr/local/bin/bsmap
007ca000-007d3000 rw-p 001ca000 08:05 1308602                            /usr/local/bin/bsmap
007d3000-007f0000 rw-p 00000000 00:00 0 
01183000-161d07000 rw-p 00000000 00:00 0                                 [heap]
7f7c3d2af000-7f7c9934f000 rw-p 00000000 00:00 0 
7f7cb4f9f000-7f7cee087000 rw-p 00000000 00:00 0 
7f7cfc093000-7f7cfc094000 rw-p 00000000 00:00 0 
7f7cfc094000-7f7cfc095000 ---p 00000000 00:00 0 
7f7cfc095000-7f7cfc895000 rw-p 00000000 00:00 0 
7f7cfc895000-7f7cfc896000 ---p 00000000 00:00 0 
7f7cfc896000-7f7cfd3a4000 rw-p 00000000 00:00 0 
7ffceb587000-7ffceb5a8000 rw-p 00000000 00:00 0                          [stack]
7ffceb5b7000-7ffceb5ba000 r--p 00000000 00:00 0                          [vvar]
7ffceb5ba000-7ffceb5bc000 r-xp 00000000 00:00 0                          [vdso]
ffffffffff600000-ffffffffff601000 r-xp 00000000 00:00 0                  [vsyscall]

Recommend Projects

  • React photo React

    A declarative, efficient, and flexible JavaScript library for building user interfaces.

  • Vue.js photo Vue.js

    🖖 Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.

  • Typescript photo Typescript

    TypeScript is a superset of JavaScript that compiles to clean JavaScript output.

  • TensorFlow photo TensorFlow

    An Open Source Machine Learning Framework for Everyone

  • Django photo Django

    The Web framework for perfectionists with deadlines.

  • D3 photo D3

    Bring data to life with SVG, Canvas and HTML. 📊📈🎉

Recommend Topics

  • javascript

    JavaScript (JS) is a lightweight interpreted programming language with first-class functions.

  • web

    Some thing interesting about web. New door for the world.

  • server

    A server is a program made to process requests and deliver data to clients.

  • Machine learning

    Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.

  • Game

    Some thing interesting about game, make everyone happy.

Recommend Org

  • Facebook photo Facebook

    We are working to build community through open source technology. NB: members must have two-factor auth.

  • Microsoft photo Microsoft

    Open source projects and samples from Microsoft.

  • Google photo Google

    Google ❤️ Open Source for everyone.

  • D3 photo D3

    Data-Driven Documents codes.