sunnyisgalaxy / moabs Goto Github PK
View Code? Open in Web Editor NEWA comprehensive, accurate and efficient solution for analysis of large scale base-resolution DNA methylation data
A comprehensive, accurate and efficient solution for analysis of large scale base-resolution DNA methylation data
HI,
I am using mcall
on bsmap
ed WGBS data which has been overlap-clipped by bamutils overlapClip
[1]. mcall crashes on data with a core cump :
strace:
[...]
[pid 29925] read(3, "CC\nGAGCAGGTTGCCCATTGAAGAGGCGGCGG"..., 8191) = 8191
[pid 29925] read(3, "TGCTGTTCTTAGAGACTGAACA\nATTAAAATA"..., 8191) = 8191
[pid 29925] read(3, "gcttaaaaagaaaaaggaaaaagaagacacag"..., 8191) = 8191
[pid 29925] read(3, "atggctgagaa\ngcacctgaaaaaaagtgttc"..., 8191) = 8191
[pid 29925] read(3, "aaggtagaaataacccaagggtcactcaacc\n"..., 8191) = 8191
[pid 29925] read(3, "\ncccacccacccccactcccctacccacccac"..., 8191) = 8191
[pid 29925] read(3, "tctcttagaatctgcatgac\nctctgaccagg"..., 8191) = 8191
[pid 29925] read(3, "ttctgtcgcacaaattatagtctttcatgaag"..., 8191) = 8191
[pid 29925] read(3, "atcttggca\nccctcttctggtgtgcaggcag"..., 8191) = 8191
[pid 29925] read(3, "CTGTAAAACACCCCACAGATAAGTAATGT\nGC"..., 8191) = 8191
[pid 29925] read(3, "ggcgtggcagaacgaatgagcaggaagctcca"..., 8191) = 5411
[pid 29925] read(3, "", 8191) = 0
[pid 29925] close(3) = 0
[pid 29925] mmap(NULL, 8392704, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS|MAP_STACK, -1, 0) = 0x7fce847f1000
[pid 29925] mprotect(0x7fce847f1000, 4096, PROT_NONE) = 0
[pid 29925] clone(strace: Process 29951 attached
child_stack=0x7fce84ff0e70, flags=CLONE_VM|CLONE_FS|CLONE_FILES|CLONE_SIGHAND|CLONE_THREAD|CLONE_SYSVSEM|CLONE_SETTLS|CLONE_PARENT_SETTID|CLONE_CHILD_CLEARTID, parent_tidptr=0x7fce84ff19d0, tls=0x7fce84ff1700, child_tidptr=0x7fce84ff19d0) = 29951
[pid 29951] set_robust_list(0x7fce84ff19e0, 24 <unfinished ...>
[pid 29925] futex(0x7fce94010f34, FUTEX_WAIT_PRIVATE, 1, NULL <unfinished ...>
[pid 29951] <... set_robust_list resumed> ) = 0
[pid 29951] write(1, "Start processing file AM-WGBS-00"..., 72Start processing file MYSAMPLE_3m_test.srt.oc.rdp.bam on chrom chr10
) = 72
[pid 29951] open("MYSAMPLE_3m_test.srt.oc.rdp.bam.chr10_skip.bed", O_WRONLY|O_CREAT|O_TRUNC, 0666) = 3
[pid 29951] write(3, "#chrom\tstart\tend\tratio\ttotalC\tme"..., 48) = 48
[pid 29951] open("MYSAMPLE_3m_test.srt.oc.rdp.bam", O_RDONLY) = 4
[pid 29951] mprotect(0x7fce8c021000, 8192, PROT_READ|PROT_WRITE) = 0
[pid 29951] lseek(4, -28, SEEK_END) = 599820951
[pid 29951] read(4, "\37\213\10\4\0\0\0\0\0\377\6\0BC\2\0\33\0\3\0\0\0\0\0\0\0\0\0", 28) = 28
[pid 29951] lseek(4, 0, SEEK_SET) = 0
[pid 29951] read(4, "\37\213\10\4\0\0\0\0\0\377\6\0BC\2\0N3", 18) = 18
[pid 29951] read(4, "\325}k\214#\311}_\355\354\356\255Nc\301\2526\r\24\201\30`3;'&\213\336c7\337\355"..., 13117) = 13117
[pid 29951] mprotect(0x7fce8c023000, 8192, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c025000, 4096, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c026000, 4096, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c027000, 40960, PROT_READ|PROT_WRITE) = 0
[pid 29951] mprotect(0x7fce8c031000, 40960, PROT_READ|PROT_WRITE) = 0
[pid 29951] futex(0x830090, FUTEX_WAKE_PRIVATE, 2147483647) = 0
[pid 29951] write(2, "terminate called after throwing "..., 48terminate called after throwing an instance of ') = 48
[pid 29951] write(2, "std::out_of_range", 17std::out_of_range) = 17
[pid 29951] write(2, "'\n", 2'
) = 2
[pid 29951] write(2, " what(): ", 11 what(): ) = 11
[pid 29951] write(2, "basic_string::substr", 20basic_string::substr) = 20
[pid 29951] write(2, "\n", 1
) = 1
[pid 29951] rt_sigprocmask(SIG_UNBLOCK, [ABRT], NULL, 8) = 0
[pid 29951] tgkill(29916, 29951, SIGABRT) = 0
[pid 29951] --- SIGABRT {si_signo=SIGABRT, si_code=SI_TKILL, si_pid=29916, si_uid=184} ---
[pid 29916] <... futex resumed>) = ?
[pid 29925] <... futex resumed>) = ?
[pid 29925] +++ killed by SIGABRT (core dumped) +++
[pid 29951] +++ killed by SIGABRT (core dumped) +++
+++ killed by SIGABRT (core dumped) +++
Aborted (core dumped)
Any idea where to start looking for the problem?
Hello,
I am trying to run mcall module but segfaulting. I've tried to google/solve it myself, but I haven't had any success.
I am running a target position specific bisulfite sequencing (not WGBS, RRBS) following the programs method listed in a paper (Targeted bisulfite sequencing of the dynamic DNA methylome, Ziller et al. 2016). Essentially it's following Bismark -> Picard (dedup, sort) -> mcall
I've used a precompiled binary in the moabs-1.3.8.7 version and 1.3.8.6 but still, the same error.
Following is from stdout.
This is the command that I used.
mcall -m <bam> -r <hg38.fa>
*I've used one sample in this example, but running multiple samples still show the same error.
./moabs.sh /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
Options are saved in file run.config and printed here:
cytosineMinScore=20
excludedFlag=0
fullMode=0
keepTemp=0
mappedFiles=/data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
minFragSize=0
minMMFragSize=0
nextBaseMinScore=3
processPEOverlapSeq=1
qualityScoreBase=0
reference=/data/REFERENCE/hg38/hg38.fa
reportCHX=X
reportCpX=G
requiredFlag=0
skipRandomChrom=1
statsOnly=0
threads=1
trimRRBSEndRepairSeq=2
trimWGBSEndRepairPE1Seq=3
trimWGBSEndRepairPE2Seq=3
Program started
From the extension of file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam, program is parsing file according to BAM foramt
XR:Z or ZR:Z:, or ZS:Z: field not found, that is totally fine.
For file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam, the quality score format is Sanger format based at 33!
Protocol and read length are detected as WGBS and 151 bases for file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam
For file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam the number of all reads is 17360352 and the number of mapped reads is 17360352
Start processing file /data/PMP/p_test/02.bm_bam/CRC_1124_1_bismark_bt2_pe.srt.bam on chrom chr1
./moabs.sh: line 9: 21517 Segmentation fault $mcall -m $inbam -r $ref
I have 256G RAM on the system. I don't know why it is giving the Segmentation fault (core dumped) error. The alignment is from bismark and properly sorted.
mcall -m CDAA158_merged_final_sorted_dedup.deduplicated.bam -m CDAA328_merged_final_sorted_dedup.deduplicated.bam -m CDAA591_merged_final_sorted_dedup.deduplicated.bam -m CDAA94_merged_final_sorted_dedup.deduplicated.bam -p 2 --sampleName CDAA -r ${GENODIR}/hg38_r87.fa --skipRandomChrom 1
When I using mcall, I have specified the output director by using --outputDir. However, there is no output files under that direction. My pipeline is:
mcall -m input.bam --outputDir fullPathToOutputDir -g danRer11 --webOutputDir fullPathToWebOutputDir -r fullPathToFastaFile -a 1 -p 4
I got this error while calling withVariance
Informational Message: The current Metropolis proposal is about to be rejected because of the following issue: stan::prob::beta_log: First shape parameter is inf, but must be finite! If this warning occurs sporadically, such as for highly constrained variable types like covariance matrices, then the sampler is fine, but if this warning occurs often then your model may be either severely ill-conditioned or misspecified.
Any idea?
Thanks
How to pass the chromosome size file to mcomp, I have seen hard coded search for mm9 chromosome size in the log
Initial command:
mcomp -p 32 -c comp.UN.vs.TR.txt --doDmrScan=1 --doDmcScan=1 --dmrMethods=2 --minCredibleDif=0.1 --maxDistConsDmcs=300
Line from log:
running: egrep -v '^track|^browser|^#' dmc_M2_0_vs_1.bed > dmc_M2_0_vs_1.temp && bedToBigBed dmc_M2_0_vs_1.temp /pillar_storage/pillar00/deqiangs/ref/mm9.chrom.sizes dmc_M2_0_vs_1.bb && rm dmc_M2_0_vs_1.temp Couldn't open /pillar_storage/pillar00/deqiangs/ref/mm9.chrom.sizes
Thanks
here is the screen output
[bsmap] @Thu Aug 15 16:07:40 2019 loading reference file: /mnt/Storage/home/wangwen/source/bySpecies/hg38/hg38_main.fa (format: FASTA)
[bsmap] @Thu Aug 15 16:08:05 2019 25 reference seqs loaded, total size 3088286401 bp. 25 secs passed
[bsmap] @Thu Aug 15 16:09:21 2019 create seed table. 101 secs passed
[bsmap] @Thu Aug 15 16:09:21 2019 Pair-end alignment(30 threads),
Input read file #1: 5-meth-293-APODEC/293APODEC_BKDL190823184-1a_1.clean_val_1.fq.gz (format: gzipped FASTQ)
Input read file #2: 5-meth-293-APODEC/293APODEC_BKDL190823184-1a_cut37_2.clean_val_2.fq.gz (format: gzipped FASTQ)
Output file: 5-meth-293-APODEC/293_APOBEC.sam*** buffer overflow detected ***: bsmap terminated
======= Backtrace: =========
[0x523e62]
[0x523dbe]
[0x523679]
[0x4d3e0d]
[0x53c6bb]
[0x523711]
[0x52365d]
[0x4252a9]
[0x4020cd]
[0x4b8714]
[0x402fa1]
======= Memory map: ========
00400000-005ca000 r-xp 00000000 08:05 1308602 /usr/local/bin/bsmap
007ca000-007d3000 rw-p 001ca000 08:05 1308602 /usr/local/bin/bsmap
007d3000-007f0000 rw-p 00000000 00:00 0
01183000-161d07000 rw-p 00000000 00:00 0 [heap]
7f7c3d2af000-7f7c9934f000 rw-p 00000000 00:00 0
7f7cb4f9f000-7f7cee087000 rw-p 00000000 00:00 0
7f7cfc093000-7f7cfc094000 rw-p 00000000 00:00 0
7f7cfc094000-7f7cfc095000 ---p 00000000 00:00 0
7f7cfc095000-7f7cfc895000 rw-p 00000000 00:00 0
7f7cfc895000-7f7cfc896000 ---p 00000000 00:00 0
7f7cfc896000-7f7cfd3a4000 rw-p 00000000 00:00 0
7ffceb587000-7ffceb5a8000 rw-p 00000000 00:00 0 [stack]
7ffceb5b7000-7ffceb5ba000 r--p 00000000 00:00 0 [vvar]
7ffceb5ba000-7ffceb5bc000 r-xp 00000000 00:00 0 [vdso]
ffffffffff600000-ffffffffff601000 r-xp 00000000 00:00 0 [vsyscall]
A declarative, efficient, and flexible JavaScript library for building user interfaces.
๐ Vue.js is a progressive, incrementally-adoptable JavaScript framework for building UI on the web.
TypeScript is a superset of JavaScript that compiles to clean JavaScript output.
An Open Source Machine Learning Framework for Everyone
The Web framework for perfectionists with deadlines.
A PHP framework for web artisans
Bring data to life with SVG, Canvas and HTML. ๐๐๐
JavaScript (JS) is a lightweight interpreted programming language with first-class functions.
Some thing interesting about web. New door for the world.
A server is a program made to process requests and deliver data to clients.
Machine learning is a way of modeling and interpreting data that allows a piece of software to respond intelligently.
Some thing interesting about visualization, use data art
Some thing interesting about game, make everyone happy.
We are working to build community through open source technology. NB: members must have two-factor auth.
Open source projects and samples from Microsoft.
Google โค๏ธ Open Source for everyone.
Alibaba Open Source for everyone
Data-Driven Documents codes.
China tencent open source team.