guipengli / chia-pet2 Goto Github PK

hello, before operate this step :tar -zxvf ChIA-PET2.tar.gz ,we should first download this resource, in my linux server ,please note the download url to get the ChIA-PET2.tar.gz file.
thanks

I tried re-analysing the publicly available encode ChIA-PET data (GSE59395), however I run into the following error at step 3:

Error: read names of PET ends do not match

I checked the read names of the input SAMs and they do appear to match as far as I can tell, excerpt below:

tail -n 2 chiapet/GSM1436262_H3K27ac_ChIAPET_K562_1.valid.sam 
SRR1514662.177322795.1	4	*	0	0	*	*	0	0	ACTCCTGATGCGAGTAAT	??@7AD?DHHDF7EF@DD	AS:i:0	XS:i:0
SRR1514662.177322797.1	4	*	0	0	*	*	0	0	AGAGCTACTACCTCTGAGG	@B@FFFFFHGHFFHGIEGG	AS:i:0	XS:i:0

tail -n 2 chiapet/GSM1436262_H3K27ac_ChIAPET_K562_2.valid.sam 
SRR1514662.177322795.2	4	*	0	0	*	*	0	0	ATGTAAATAGCTACAAGGA	B<+4AAAB?BBBFG@@<?3	AS:i:0	XS:i:0
SRR1514662.177322797.2	4	*	0	0	*	*	0	0	AAGATGCCCATAAAGGGA	C@CFFDFFHHHHHJJJJJ	AS:i:0	XS:i:0

Any idea what might be causing this?

(ChIA-PET2 version 0.9.2)

Thanks,
Mark

Dear all,
It writes the following in the log file:

[08-02 01:26:25] Running Step 2: BWA ...

bwa_wrap /work/pathology/s206442/dbet_project/hg19/hg19.fa Output3/out_1.valid.fastq 6 Output3/out_1.valid.sam 0
Running BWA on trimmed reads ...
bwa mem -t 6 /work/pathology/s206442/dbet_project/hg19/hg19.fa Output3/out_1.valid.fastq | samtools view -h -F 2048 - > Output3/out_1.valid.sam

However, the sam file size is always 0 Bytes. Nothing written to it since very long time.

Any suggestions?

Thank you

Hi @GuipengLi @titosand ,

I am using this tool to analysis ChIAPET data. I get the following error:

**Error: line number 221500057 of file ChIAPETV2_raw.rmdup.bedpe.tag.sorted has 3 fields, but 6 were expected.**

I checked the line, it is truncated (chr20 62917478 62917 ), while the unsorted .tag file has all the values I am not sure why is this happening. The script haulted after this step. I ran the script/pipeline twice, after correcting the specified line but each time similar error pops up. I have ran this tool several times before with different datasets, I never got such an error. Not sure what am I missing. Any help would be appreciated to resolve this error.

Thank you!

Hi,

I get the below mentioned error when I try to run Chiapet2 tool on subsampled reads. It was running fine for the reads before. Following is the command I am using:

seqtk sample -s100 SRR_1.fastq.gz 0.1 >R1_1_sub0.1.fastq
seqtk sample -s100 SRR_2.fastq.gz 0.1 >R2_2_sub0.1.fastq

####Running ChIA-PET2 :

ChIA-PET2-0.9.3/bin/ChIA-PET2 -t 10 -g hg19.fa -b hg19.chrom.sizes -f R1_1_sub0.1.fastq.gz -r R2_2_sub0.1.fastq.gz -m 1 -A CGCGATATCTTATCTGACT -B GTCAGATAAGATATCGCGT -e 2 -k 2 -l 12 -C 1 -o 0.1 -n ChIAPETV2_0.1

Error message:
ERROR: The input file is neither a BAM file nor a SAM file.

my code:
~/software/executable_file/R-3.4.3/bin/Rscript /public1/home/pg3152/lien/software/ChIA-PET2-master/bin/MICC2.R seedling_H3K4me3_interactions.intra.bedpe seedling_H3K4me3_interactions.inter.bedpe miccOUT 3 6 1e-10

Output for running MICC.R:
Loading required package: VGAM
Loading required package: methods
Loading required package: stats4
Loading required package: splines
Running MICC...
Intra data: seedling_H3K4me3_interactions.intra.bedpe
Inter data: seedling_H3K4me3_interactions.inter.bedpe
Output file: miccOUT
PET count cutoff: 3
Minimun Confident PET count: 6
reltol: 1e-10
Loading intra data...
Loading inter data...
Cacluating...
Intra: 24481 Inter: 27511
Error in optim(InitialValue, fn = Loglik.theta12.params, gr = D1.Loglik.theta12.params, :
L-BFGS-B needs finite values of 'fn'
Calls: MICCoutput2 ... Estimate.Theta12.params -> Solve.Theta12.params -> optim
Execution halted

When I compile the package, it shows:
g++ -Wall -O2 -Wno-char-subscripts -fopenmp -o /Users/xiangwang/ChIA-PET2/bin/trimLinker /Users/AA/ChIA-PET2/src/trimLinker.cpp -lz
clang: error: unsupported option '-fopenmp'
clang: error: unsupported option '-fopenmp'

I am analyzing K562 and MCF7 using ChIA-PET2 tools using the following script
ChIA-PET2 -g ~/data/reference/hg19.fa -b ~/data/human.hg19.genome/hg19.chrom.sizes.txt -f ~/data/MCF7/MCF7_1.fastq -r ~/data/MCF7/MCF7_2.fastq -o ~/results/ChIA-PET2/MCF7/ -n MCF7 -d 1

I got the MCF7.interactions.MICC and K562.interactions.MICC and then after, I filter the significant interaction with FDR < 0.05 and got the following output

- wc -l MCF7.interactions.MICC = 9451
- awk '($13 < 0.05)' MCF7.interactions.MICC | wc -l = 0 
- wc -l K562.interactions.MICC = 15222
- awk '($13 < 0.05)' K562.interactions.MICC | wc -l = 4733

I am confused on the MCF7 data set that how all interaction are not significant. Therefore, would you please give some hint about how we get the significant interaction using your tool or can we consider all the loops inside .MICC file as significant interactions.

Hi Guipeng,
I'm running ChIA-PET2 on the bridge-linker experiment and it stopped at stage 5 psort without warning. my command was like this:

ChIA-PET2 -t 8 -g /espresso/share/genomes/hg19/Sequence/BWAIndex/genome.fa -b /opt/apps/rhel6/bedtools/2.25.0/genomes/human.hg19.genome -f SYN_HepG2_RAD21_r1.fastq -r SYN_HepG2_RAD21_r2.fastq -o ./ChIA-PET2 -n ChIA-PET2_HepG2_RAD21 -k 2 -m 1

and the pipeline just stopped here:

[04-24 12:03:19] Running Step 5: Detect Interactions ...

extendpeak ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.narrowPeak 500 ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.slopPeak
Running extendpeak...
bedtools slop -i ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.narrowPeak -g /opt/apps/rhel6/bedtools/2.25.0/genomes/human.hg19.genome -b 500 | bedtools merge -d 256 > ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.slopPeak
awk 'BEGIN{OFS="\t";i=1}{print $1,$2,$3,"peak_"i;i=i+1}' ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.slopPeak > tmp.bed; mv tmp.bed ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.slopPeak
peak_depth2 ./ChIA-PET2/ChIA-PET2_HepG2_RAD21.rmdup.bedpe.tag 100 ./ChIA-PET2/ChIA-PET2_HepG2_RAD21_peaks.slopPeak ./ChIA-PET2/ChIA-PET2_HepG2_RAD21.peaks.depth
Running peakdepth...
psort ./ChIA-PET2/ChIA-PET2_HepG2_RAD21.rmdup.bedpe.tag ./ChIA-PET2/ChIA-PET2_HepG2_RAD21.rmdup.bedpe.tag.sorted > /dev/null 2>&1

the bedpe file was empty. it seems the split sorted file failed to cat into one. Do you know how to fix that?
Thank you!
Raye

Hi, I was trying to use CHia-Pet, but Problems emerged：
“”“
bwa_wrap bwaindex_chr1.fa output/out_1.valid.fastq 8 output/out_1.valid.sam 0
Running BWA on trimmed reads ...
bwa mem -t 8 bwaindex_chr1.fa output/out_1.valid.fastq | samtools view -h -F 2048 - > output/out_1.valid.sam
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[M::process] read 3906886 sequences (80000033 bp)...
[M::process] read 3906400 sequences (80000011 bp)...
”“”
for my input command, "bwaindex_chr1.fa" is a prefix, those file are bwaindex_chr1..fa.ann, .sa...etc which was generated by bwa tools, for bwa tools I just use this command:
"bwa index -a bwtsw -p bwaindex_chr1.fa chr1.fa"

I was trying to fix this problem couple of days but its still exists

Hi,

The pipeline always throws an error at the 'buildBedpe' step:

terminate called after throwing an instance of ‘std::bad_alloc’
what(): std::bad_alloc
Aborted (core dumped)

I'm not sure why this is. I tried 3 different servers and all of them should have enough available memory.

Thanks,
Ruben

Hey,

I just installed CPT2 on my system (mac high sierra) and I tried to run ti using the command that you have as an example:
ChIA-PET2 -g genomeindex -b bedtoolsgenome -f fq1 -r fq2 -A linkerA -B linkerB -o OUTdir -n prefixname

Where my variables are specified accordingly.
However when I run this I only get the following output:

usage : ChIA-PET2 -g genomeindex -b bedtoolsgenome -f fq1 -r fq2 -A linkerA -B linkerB -o OUTdir -n prefixname
Use option -h|--help for more information

And the program is not running. It does not return any error message, it just prints the above output all the time.

What is the issue?

Thanks

Hello,

I have a problem with the second step.
If bwa mem output is a sam file shouldn't it be using -S for samtools view?

bwa_wrap GRCh38.d1.vd1.fa output/out_1.valid.fastq 1 output/out_1.valid.sam 0
Running BWA on trimmed reads ...
bwa mem -t 1 GRCh38.d1.vd1.fa output/out_1.valid.fastq | samtools view -h -F 2048 - > output/out_1.valid.sam
[bam_header_read] EOF marker is absent. The input is probably truncated.
[M::bwa_idx_load_from_disk] read 0 ALT contigs
[bam_header_read] invalid BAM binary header (this is not a BAM file).
[main_samview] fail to read the header from "-".
ERROR in running bwa ...

Thanks!

Hi,
I am running trimLinker through CHIA-PET2 with 14 threads. After about 90 minutes, there are only 14.5K reads in the output directory FASTQ files. Considering that my input FASTQs are about 70GB compressed (Tang Cell 2015), I think it will take several days to get through the linker trimming step. Am I doing something wrong? ChIA-PET2 command line is:
/home/rkarnik/sw/ChIA-PET2/bin/ChIA-PET2 -g /home/rkarnik/w/genomes/hg19/bwa/hg19 -b /home/rkarnik/w/genomes/hg19/hg19.chrom.sizes -f SRR2312566_1.fastq.gz -r SRR2312566_2.fastq.gz -m 1 -e 1 -t 14

when type
> trimLinker -h
not only print the help page but also print: Wrong parameters

thought it is not a big issue

Hello Guipeng Li,
Quick question: If m is set to 2, what sequence to put in for A and B? Are we required to set those parameters or is there a way to set them off?

Thanks,
Gunjan

#phase.bedpe.flt.bed
chr1 37591585 37591699 chrX 122699482 122699588 SRR2312567.755 . + -
CGCCTTGCCAGGTGTCACTGTCCTCCTGCCCCAGTGGAGCAGTCGCCCTTACTGTCAGCCACACAGTCATTCTTCCAAACCATTAAATAATTGGGAACTTTTCATTACTTAAGA
TAAGACTTAAATGTAAAACCCAAAACTATAAACACTCTAGAAGAAAAGCATATCATCCATTTTGCAACATACAGAGAATTAATAAATGTAGGCATTGACTATCAAC
chrX 122699585 122699586 C A

#bedpe2Phased phase.bedpe.flt.bed phase.out
chr1 37591585 37591699 chrX 122699482 122699588 0 2

#run bedpe2Phased:
int id = vcfstart-start2
=122699585-122699482
=103
string snp = seq2.substr(id,1)
="A"
But: the SNP loci is id-1 => should be "C"

#hg19 、maternal、paternal seqences for this reads

a::chrX:122699482-122699588
aaagacttaaatgtaaaacccaaaactataaacactctagaagaaaagcatatcatccattttgcaacatacagagaattaataaatgtaggcattgactatcaac

a::X_maternal:122696441-122696547
AAAGACTTAAATGTAAAACCCAAAACTATAAACACTCTAGAAGAAAAGCATATCATCCATTTTGCAACATACAGAGAATTAATAAATGTAGGCATTGACTATAAAC

a::X_paternal:122695293-122695399
AAAGACTTAAATGTAAAACCCAAAACTATAAACACTCTAGAAGAAAAGCATATCATCCATTTTGCAACATACAGAGAATTAATAAATGTAGGCATTGACTATCAAC
notes: I use **A/C ** flag the snp loci

Hi, Guipeng,
I'm trying to call interactions on this dataset from encode: https://www.encodeproject.org/experiments/ENCSR000BZX/
Since I saw people in previous posts had the same problem I checked my data, tried a few times and used the command as follows:
ChIA-PET2 -g ./BWAIndex/genome.fa -b ./human.hg19.genome -f HCT116_POL2_r1.fastq -r HCT116_POL2_r2.fastq -o ./ChIA-PET2 -n ChIA-PET2_HCT116_POL2 -d 1 -Q 20
And this is what I got from step 7:

Loading required package: VGAM
Loading required package: methods
Loading required package: stats4
Loading required package: splines
Running MICC...
Intra data: ./ChIA-PET2_HCT116_POL2.interactions.intra.bedpe
Inter data: ./ChIA-PET2_HCT116_POL2.interactions.inter.bedpe
Output file: ./HCT116_POL2_interactions.out
PET count cutoff: 2
Minimun Confident PET count: 5
reltol: 1e-08
Loading intra data...
Loading inter data...
Cacluating...
Intra: 1083 Inter: 9184
Error: Don't have enough confident interactions to learn the model.
Execution halted

the QC plot is like this.
ChIA-PET2_HCT116_POL2.QCplot.pdf
The interchromosomal interaction portion is relatively high, while I'm not sure if this is the problem. Could you help me on that? Thanks!

Rayezh

Dear admin,

Thank you for creating this tool. I was able to install this tool easily in a system having Fedora OS.

However when I tried installing it in a system with an Ubuntu 15.10, the installation fails.

The following messages appear in the terminal:

"g++ -Wall -O2 -Wno-char-subscripts -lz -fopenmp -o /home/chadiak/Apps/ChIA-PET2/bin/trimLinker /home/chadiak/Apps/ChIA-PET2/src/trimLinker.cpp
/tmp/cct7x7hm.o: In function read_fastq(gzFile_s*&, int)': trimLinker.cpp:(.text+0x44bc): undefined reference togzgets'
trimLinker.cpp:(.text+0x44cd): undefined reference to gzgets' trimLinker.cpp:(.text+0x45aa): undefined reference togzgets'
trimLinker.cpp:(.text+0x45f3): undefined reference to gzgets' /tmp/cct7x7hm.o: In functionparseFastqgz_p(int, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, unsigned long, int, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, int)':
trimLinker.cpp:(.text+0x483b): undefined reference to gzopen' trimLinker.cpp:(.text+0x484e): undefined reference togzopen'
trimLinker.cpp:(.text+0x4cc7): undefined reference to gzclose' trimLinker.cpp:(.text+0x4cd1): undefined reference togzclose'
/tmp/cct7x7hm.o: In function parseFastqBridgegz_p(int, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, unsigned long, int, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, int)': trimLinker.cpp:(.text+0x527b): undefined reference togzopen'
trimLinker.cpp:(.text+0x528e): undefined reference to gzopen' trimLinker.cpp:(.text+0x5707): undefined reference togzclose'
trimLinker.cpp:(.text+0x5711): undefined reference to gzclose' /tmp/cct7x7hm.o: In functionparseFastqEnzymegz_p(int, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, unsigned long, int, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, int)':
trimLinker.cpp:(.text+0x5d0e): undefined reference to gzopen' trimLinker.cpp:(.text+0x5d21): undefined reference togzopen'
trimLinker.cpp:(.text+0x6187): undefined reference to gzclose' trimLinker.cpp:(.text+0x6191): undefined reference togzclose'
/tmp/cct7x7hm.o: In function parseFastqgz(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, unsigned long, unsigned long, int, bool, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, int)': trimLinker.cpp:(.text+0x7c6a): undefined reference togzopen'
trimLinker.cpp:(.text+0x7c7d): undefined reference to gzopen' trimLinker.cpp:(.text+0x7e6e): undefined reference togzgets'
trimLinker.cpp:(.text+0x7eb3): undefined reference to gzgets' /tmp/cct7x7hm.o: In functionparseFastqBridgegz(std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, unsigned long, unsigned long, int, bool, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, std::__cxx11::basic_string<char, std::char_traits, std::allocator >, int)':
trimLinker.cpp:(.text+0x8fea): undefined reference to gzopen' trimLinker.cpp:(.text+0x8ffd): undefined reference togzopen'
trimLinker.cpp:(.text+0x91ee): undefined reference to gzgets' trimLinker.cpp:(.text+0x9233): undefined reference togzgets'
/tmp/cct7x7hm.o: In function parseFastqEnzymegz(std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, unsigned long, unsigned long, int, bool, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, std::__cxx11::basic_string<char, std::char_traits<char>, std::allocator<char> >, int)': trimLinker.cpp:(.text+0xafd5): undefined reference togzopen'
trimLinker.cpp:(.text+0xafe8): undefined reference to gzopen' trimLinker.cpp:(.text+0xb1c6): undefined reference togzgets'
trimLinker.cpp:(.text+0xb206): undefined reference to `gzgets'
collect2: error: ld returned 1 exit status
Makefile:42: recipe for target 'trimLinker' failed
make: *** [trimLinker] Error 1"

Can you kindly assist in rectifying the above mentioned issue?

Best Wishes

Hi,

I have been using CPT2 to analysis POL2 ChIA-PET data from human K562 cells which mentioned in the paper.
I got ~20bp trimmed reads after the TrimLinker step. And here's the trim report:

Total PETs: 75575544
Expect PETs: 70963414
Expect both PETs: 70963414
Chim PETs: 888310
1Empty PETs: 2558187
2Empty PETs: 1080184
Valid PETs: 69936624

But there was no aligned reads after running bwa(0.7.17), here's the buildBedpe stat:

All 69936624
Reads1 Low MAPQ 0
Reads1 Unmapped 69936624
Reads2 Low MAPQ 0
Reads2 Unmapped 69936624
Output PETs 0

And then I tried the '-d 1' option you suggested, still no aligned reads reported.

My commend were:
ChIA-PET2 -g <bwa_index> -b chrom_hg19.sizes -f rnap2_chiapet_saturate_1.fastq.gz -r rnap2_chiapet_saturate_2.fastq.gz -A GTTGGATAAG -B GTTGGAATGT -o pol2/ -n saturate --thread 8 -e 1

Rerun mapping step:
bwa mem -d 1 -t 10 <bwa_index> | samtools view -h -F 2048 - > saturate_1.valid.sam bwa mem -d 1 -t 10 <bwa_index> | samtools view -h -F 2048 - > saturate_2.valid.sam ChIA-PET2 -g <bwa_index> -b chrom_hg19.sizes -f rnap2_chiapet_saturate_1.fastq.gz -r rnap2_chiapet_saturate_2.fastq.gz -A GTTGGATAAG -B GTTGGAATGT -o pol2/ -n saturate --thread 10 -e 1 -s 3

Thanks for your help!

Hi,it is a very useful tool for ChIA-PET.But what does parameter “-K” (0,1,2) means? And how the step “remove duplicates ” work？ Is it significant to remove duplicatied reads pair？

Thanks！

Hi @GuipengLi ,

I get the following error message at step 7:

Loading required package: VGAM

Warning message:

In library(package, lib.loc = lib.loc, character.only = TRUE, logical.return = TRUE,  :

  there is no package called 'VGAM'

Error in zeta(theta) : could not find function "zeta"

Calls: MICCoutput2 ... optim -> <Anonymous> -> fn -> logF1 -> ZetaTruncated

Execution halted

I tried to install VGAM separately and exported its path, but it still gives this error and the script halts. I am using R 3.6.3. It worked all right before not sure what changed now. Any help would be appreciated. Thanks!

I'm running into what seems to be an issue with the BWA alignment. The linker trimming goes fine, but the alignment spits out header-only SAM files that lead to buildBedpe crashing. I'm using BWA 0.7.15. The output/error log is attached. Thanks for any help!

ChIA-PET2_test_OE.txt

I am using conda environment and compliers are installed in custom path.

The error 'ld missing -lz' appeared when running the make command. This is minor but could take some time to fix for those (eg myself) who are not experienced in compiling source c/cpp code.

The solution here dose not suit all cases, but it would give you a hint to solve the error quickly.

Open and edit the Makefile

# custome g++ complier
CC=/path/to/g++
# custome include library and lib
CFLAGS=-Wall -O2 -Wno-char-subscripts -fopenmp -I/path/to/your/zlib/include -L/path/to/your/zlib/lib

Hint: To locate your custom zlib include and lib directories, you can run command like

find /path/to/possible/dir '*' | grep zlib

The above settings do not fix the error of compiling bedpe2Matrix because it uses different compile options. To fix this

1. Open Makefile and find the line $(CC) -Wall -O2 -std=c++0x -o ${BIN}/$@ ${SOURCES}/bedpe2Matrix.cpp ${LDFLAGS}

2. Add -I /path/to/your/zlib/include -L /path/to/your/zlib/lib before -Wall parameter

Hi @GuipengLi ,
An error was reported when I run bedpe2Interaction.

bedpe2Interaction RAD21_ChIAPET.rmdup.bedpe.tmp RAD21_ChIAPET.interactions RAD21_ChIAPET.stat
Running bedpe2Interaction...
Segmentation fault (core dumped)

The input file format is as follows,
head RAD21_ChIAPET.rmdup.bedpe.tmp
chrX 38634826 38634927 chrX 38634869 38634970 SRR8659342.732269 . + - chrX 38633862 38635745 553
chrX 38634826 38634927 chrX 38634869 38634970 SRR8659342.732269 . + - chrX 38633862 38635745 553
chrX 36866684 36866785 chrX 36866967 36867066 SRR8659342.4394649 . + - chrX 36866138 36868189 237
chrX 36866684 36866785 chrX 36866967 36867066 SRR8659342.4394649 . + - chrX 36866138 36868189 237
chr15 77107681 77107782 chr15 77107755 77107797 SRR8659342.2501571 . + - chr15 77106748 77108892 996
chr15 77107681 77107782 chr15 77107755 77107797 SRR8659342.2501571 . + - chr15 77106748 77108892 996
chrX 37059730 37059831 chrX 37059852 37059953 SRR8659342.3183715 . + - chrX 37059546 37061952 380
chrX 37059730 37059831 chrX 37059852 37059953 SRR8659342.3183715 . + - chrX 37059546 37061952 380
chr15 74373832 74373933 chr15 74373935 74374036 SRR8659342.8464568 . + - chr15 74372747 74376257 3104
chr15 74373832 74373933 chr15 74373935 74374036 SRR8659342.8464568 . + - chr15 74372747 74376257 3104

I have no idea where the problem is, could you give me some advice. Thanks so much!

Hi, I'm running into the above error for step 7 in the pipeline. Can someone better explain what the issue is (i.e. what makes a confident interaction, how many do I need), and if there are any methods for getting around this? Thank you for all your help!

This is my dataset: https://www.encodeproject.org/experiments/ENCSR752QCX/ (Using the 2x14G paired ends)
Below is the terminal output for the last few steps:

EDIT: It seems that the value of confidentN=0. I've also attached the output of QCplot, which shows a value of NaN for chromosome interactions. I find it strange that not a single interaction passes the threshold.
out.QCplot.pdf

`'[10-12 01:24:13] Running Step 5: Detect Interactions ...

extendpeak output/out_peaks.narrowPeak 500 output/out_peaks.slopPeak
Running extendpeak...
bedtools slop -i output/out_peaks.narrowPeak -g genome/chrom_hg19_ebv.sizes -b 500 | bedtools merge -d 256 > output/out_peaks.slopPeak
awk 'BEGIN{OFS="\t";i=1}{print $1,$2,$3,"peak_"i;i=i+1}' output/out_peaks.slopPeak > tmp.bed; mv tmp.bed output/out_peaks.slopPeak
peak_depth2 output/out.rmdup.bedpe.tag 100 output/out_peaks.slopPeak output/out.peaks.depth
Running peakdepth...
psort output/out.rmdup.bedpe.tag output/out.rmdup.bedpe.tag.sorted > /dev/null 2>&1
psort output/out_peaks.slopPeak output/out_peaks.slopPeak.sorted > /dev/null 2>&1
bedtools coverage -sorted -b output/out.rmdup.bedpe.tag.sorted -a output/out_peaks.slopPeak.sorted -counts > output/out.peaks.depth
build_interaction output/out.rmdup.bedpe output/out.peaks.depth output/out.interactions output/out.bedpe.stat
Running build_interaction...
pairToBed -a output/out.rmdup.bedpe -b output/out.peaks.depth -type both > output/out.rmdup.bedpe.tmp
bedpe2Interaction output/out.rmdup.bedpe.tmp output/out.interactions output/out.bedpe.stat
Running bedpe2Interaction...
PETs in the same peak: 700
Intra PETs bewteen two peaks: 106
Inter PETs bewteen two peaks: 717
Intra loops: 106
Inter loops: 717

[10-12 01:24:20] Running Step 6: QCplots ...

Rscript /mnt/data/scu/bin/ChIA-PET2_0.9.2/bin/QCplots.R output out
Loading required package: ggplot2
Loading required package: scales
null device
1

[10-12 01:24:21] Running Step 7: MICC ...

Rscript /mnt/data/scu/bin/ChIA-PET2_0.9.2/bin/MICC2.R output/out.interactions.intra.bedpe output/out.interactions.inter.bedpe output/out.interactions.MICC 1
Loading required package: VGAM
Loading required package: methods
Loading required package: stats4
Loading required package: splines
Warning message:
replacing previous import by ‘splines::splineDesign’ when loading ‘VGAM’
Running MICC...
Loading intra data...
Loading inter data...
Cacluating...
Error: Don't have enough confident interactions to learn the model.
`

Hello!
I want to know the detailed command of macs2 calling peaks.There are only a little peaks found by the software when the default parameter was used.Can you help me ?
Thank you very much!

Hi,
I am trying to read through the ChIA-PET2 code to re-implement the algorithm in our own pipeline. I had a question about the extend parameter: the current code seems to use "peak_depth2" in bin/utils, which does not extend the reads before doing the coverageBed call. Is my reading of the code correct? Is the read extension only needed for short read data?