stephenturner / adapters

Adapters for trimming

Adapters for trimming

Source code for trimmomatic and bbmap each contain fasta files with adapter files used for trimming. The combine_adapters.R file in this directory will recursively search for any files ending in .fa. It will then combine them all, the look for unique sequences. If a single sequence has multiple entries within or between files, its sequence ID will be concatenated in a final combined fasta file. The final combined fasta file is written out with the number of unique sequences embedded in its filename.

For instance, the sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC is represented in one file as >PE2_rc and in another file as >TruSeq3_IndexedAdapter. In the combined output file, it is represented once as >PE2_rc | >TruSeq3_IndexedAdapter.

The final combined fasta file for all adapters included here is: adapters_combined_152_unique.fasta.

Please see CONTRIBUTING.md if you wish to add to this repo.

adapters's Issues

add fastqc adapters

See https://github.com/s-andrews/FastQC/blob/7812d53629ad7b5ad5cd72f2431f7fcf3b20fbce/Configuration/contaminant_list.txt

Need to reformat this into a regular fasta, then drop in a subdirectory