Hi, for testing Isaac aligner I put the command into a bash script:

#!/bin/bash

## Isaac Version: iSAAC-01.14.07.17

## Read naming
# lane3_read1.fastq.gz -> ../PhiX_S1_L003_R1_001.fastq.gz
# lane3_read2.fastq.gz -> ../PhiX_S1_L003_R2_001.fastq.gz

## Reference
## PhiX_NC_001422.1.fasta ==>
## isaac-sort-reference --genome-file $(pwd)/PhiX_NC_001422.1.fasta --jobs 12 --output-directory iSAACIndex.PhiX.20140901 --annotate
##

START_DIR=$(pwd)

BIN='isaac-align'
CPU=12
MEM=128000 # GB

GENOME="/path/to/PhiX/iSAACIndex.PhiX.20140901/sorted-reference.xml"
PROJ='PhiX-Test'
NAME='PhiX_NC_001422'
OUT="${PROJ}_Aligned_${NAME}"
TMP="$START_DIR/temp"

PARAM="\
 --base-calls $START_DIR \
 --base-calls-format fastq-gz \
 --default-adapters Standard \
 --description 'Erster Isaac Test Run (PhiX)' \
 --jobs $CPU \
 --memory-limit $MEM \
 --output-directory $OUT \
 --realign-dodgy \
 --realign-gaps all \
 --reference-genome $GENOME \
 --reference-name $NAME \
 --scatter-repeats \
 --single-library-samples \
 --temp-directory $TEMP \
 --verbosity 3 \
"

## execution
$BIN $PARAM 2>&1 | tee "${OUT}.log"

to align a pair of fastq files against sorted phix.

I always get:

Failed to parse the options: Throw location unknown (consider using BOOST_THROW_EXCEPTION)
Dynamic exception type: boost::exception_detail::clone_impl<boost::exception_detail::error_info_injector<boost::program_options::too_many_positional_options_error> >
std::exception::what: too many positional options have been specified on the command line

Version iSAAC-01.14.07.17 compiled from GIT.

Any idea what goes wrong there?

best,
Sven

As input I've used a pair of fastq-gz wgs from HiseqX
about 80G for R1 and R2 together.

The output bam sizes are about 1G only

I am just trying to reproduce the results with the NA12878 dataset that you included in your paper.
I obtained the input dataset from the GATK bundle dataset. It is in bam format.
I used the parameters described in the paper.

Execution aborted with the message xmlTextReaderRead failed

I have not seen this kind of error before. What causes it? How can I correct the problem?

This is the error log

[grendon@vlad-hm]$ more ../tmp/isaac_aligner_NA12878_w_parms_from_paper_thr8_mem150
2014-10-18 18:43:19 [7f3f776017c0] Forcing LC_ALL to C
2014-10-18 18:43:19 [7f3f776017c0] Version: iSAAC-01.14.04.17
2014-10-18 18:43:19 [7f3f776017c0] argc: 25 argv: /home/grendon/bin/iSAAC-i
nstall/bin/isaac-align -r /home/genome/build/HG19_WholeGenome/HG19_WholeGenome.f
a -m 150 -b /home/grendon/reads/NA12878/NA12878.hiseq.wgs.bwa.raw.bam --base-cal
ls-format bam -j 8 --base-quality-cutoff 15 --pf-only 1 --keep-duplicates 1 --ke
ep-unaligned back --stats-image-format none --barcode-mismatches 1 --use-bases-m
ask Y100n,Y100n
2014-10-18 18:43:19 [7f3f776017c0] Opened bam stream on "/home/grendon/read
s/NA12878/NA12878.hiseq.wgs.bwa.raw.bam"
2014-10-18 18:43:19 [7f3f74fca700] BAM Header skipped
2014-10-18 18:43:19 [7f3f74fca700] Will need to skip 45 reference sequences
2014-10-18 18:43:19 [7f3f74fca700] BAM References skipped
2014-10-18 18:43:19 [7f3f74fca700] suspending on thread 0 unparsed: 2 lastU
nparsedBytes_:0
2014-10-18 18:43:19 [7f3f74fca700] BamLoader::returnParseSlot nextParserThr
ead_:0
2014-10-18 18:43:19 [7f3f776017c0] use bases mask: yyyyyyyyyyyyyyyyyyyyyyyy
yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn,yy
yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy
yyyyyyyyyyyyyyyyyyn
2014-10-18 18:43:19 [7f3f776017c0] reads parsed: 2
2014-10-18 18:43:19 [7f3f776017c0] Discovered data read: ReadMetadata(1, 10
0 [1, 100], 0id, 0off,1frc)
2014-10-18 18:43:19 [7f3f776017c0] Discovered data read: ReadMetadata(2, 10
0 [102, 201], 1id, 100off,102frc)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
0, 32, 0, 0)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
68, 32, 0, 1)
2014-10-18 18:43:19 [7f3f776017c0] constructed SeedMetadata(32, 32, 0, 2)
2014-10-18 18:43:19 [7f3f776017c0] constructed overlapping SeedMetadata(16,
32, 0, 3)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
0, 32, 1, 4)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
68, 32, 1, 5)
2014-10-18 18:43:19 [7f3f776017c0] constructed SeedMetadata(32, 32, 1, 6)
2014-10-18 18:43:19 [7f3f776017c0] constructed overlapping SeedMetadata(16,
32, 1, 7)
2014-10-18 18:43:19 [7f3f776017c0] Generated 'none' barcode: BarcodeMetadat
a(20FUKAAXX100202,1,default,none,(0), 4294967295)
2014-10-18 18:43:19 [7f3f776017c0] align: Setting memory limit to 161061273
600 bytes.
:1: parser error : Document is empty

chrM
^
Error: 2014-Oct-18 18:43:19: Success: /home/grendon/bin/isaac_aligner-master/src
/c++/lib/xml/XmlReader.cpp(333): Throw in function bool isaac::xml::XmlReader::r
ead()
Dynamic exception type: boost::exception_detail::clone_impl<isaac::xml::XmlReade
rException>
std::exception::what: xmlTextReaderRead failed
: xmlTextReaderRead failed
[grendon@vlad-hm scripts]$ emacs isaac_align_NA12878.sh [grendon@vlad-hm scripts]$ more ../tmp/isaac_aligner_NA12878_w_parms_from_paper_thr8_mem150
2014-10-18 18:43:19 [7f3f776017c0] Forcing LC_ALL to C
2014-10-18 18:43:19 [7f3f776017c0] Version: iSAAC-01.14.04.17
2014-10-18 18:43:19 [7f3f776017c0] argc: 25 argv: /home/grendon/bin/iSAAC-i
nstall/bin/isaac-align -r /home/genome/build/HG19_WholeGenome/HG19_WholeGenome.f
a -m 150 -b /home/grendon/reads/NA12878/NA12878.hiseq.wgs.bwa.raw.bam --base-cal
ls-format bam -j 8 --base-quality-cutoff 15 --pf-only 1 --keep-duplicates 1 --ke
ep-unaligned back --stats-image-format none --barcode-mismatches 1 --use-bases-m
ask Y100n,Y100n
2014-10-18 18:43:19 [7f3f776017c0] Opened bam stream on "/home/grendon/read
s/NA12878/NA12878.hiseq.wgs.bwa.raw.bam"
2014-10-18 18:43:19 [7f3f74fca700] BAM Header skipped
2014-10-18 18:43:19 [7f3f74fca700] Will need to skip 45 reference sequences
2014-10-18 18:43:19 [7f3f74fca700] BAM References skipped
2014-10-18 18:43:19 [7f3f74fca700] suspending on thread 0 unparsed: 2 lastU
nparsedBytes_:0
2014-10-18 18:43:19 [7f3f74fca700] BamLoader::returnParseSlot nextParserThr
ead_:0
2014-10-18 18:43:19 [7f3f776017c0] use bases mask: yyyyyyyyyyyyyyyyyyyyyyyy
yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn,yy
yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyy
yyyyyyyyyyyyyyyyyyn
2014-10-18 18:43:19 [7f3f776017c0] reads parsed: 2
2014-10-18 18:43:19 [7f3f776017c0] Discovered data read: ReadMetadata(1, 10
0 [1, 100], 0id, 0off,1frc)
2014-10-18 18:43:19 [7f3f776017c0] Discovered data read: ReadMetadata(2, 10
0 [102, 201], 1id, 100off,102frc)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
0, 32, 0, 0)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
68, 32, 0, 1)
2014-10-18 18:43:19 [7f3f776017c0] constructed SeedMetadata(32, 32, 0, 2)
2014-10-18 18:43:19 [7f3f776017c0] constructed overlapping SeedMetadata(16,
32, 0, 3)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
0, 32, 1, 4)
2014-10-18 18:43:19 [7f3f776017c0] constructed extremity seed SeedMetadata(
68, 32, 1, 5)
2014-10-18 18:43:19 [7f3f776017c0] constructed SeedMetadata(32, 32, 1, 6)
2014-10-18 18:43:19 [7f3f776017c0] constructed overlapping SeedMetadata(16,
32, 1, 7)
2014-10-18 18:43:19 [7f3f776017c0] Generated 'none' barcode: BarcodeMetadat
a(20FUKAAXX100202,1,default,none,(0), 4294967295)
2014-10-18 18:43:19 [7f3f776017c0] align: Setting memory limit to 161061273
600 bytes.
:1: parser error : Document is empty
chrM
^
Error: 2014-Oct-18 18:43:19: Success: /home/grendon/bin/isaac_aligner-master/src
/c++/lib/xml/XmlReader.cpp(333): Throw in function bool isaac::xml::XmlReader::r
ead()
Dynamic exception type: boost::exception_detail::clone_impl<isaac::xml::XmlReade
rException>
std::exception::what: xmlTextReaderRead failed
: xmlTextReaderRead failed

Hi,

isaac-align is stuck at Determining memory capacity for Fastq data :

command:

isaac-align --base-calls /path/to/install/Isaac/data_files/PhiX/isaac_test --base-calls-format fastq-gz --default-adapters Standard --memory-limit 12 --reference-genome /path/to/install/Isaac/data_files/PhiX/iSAACIndex.PhiX.20140901/sorted-reference.xml
2014-09-01 16:20:10     [7f89350aa780]  Forcing LC_ALL to C
2014-09-01 16:20:10     [7f89350aa780]  Version: iSAAC-01.14.07.17
2014-09-01 16:20:10     [7f89350aa780]  argc: 11 argv: isaac-align --base-calls /path/to/install/Isaac/data_files/PhiX/isaac_test --base-calls-format fastq-gz --default-adapters Standard --memory-limit 12 --reference-genome /path/to/install/Isaac/data_files/PhiX/iSAACIndex.PhiX.20140901/sorted-reference.xml
2014-09-01 16:20:10     [7f89350aa780]  Opened fastq stream on /path/to/install/Isaac/data_files/PhiX/isaac_test/lane3_read1.fastq.gz
2014-09-01 16:20:10     [7f89350aa780]  Opened fastq stream on /path/to/install/Isaac/data_files/PhiX/isaac_test/lane3_read2.fastq.gz
2014-09-01 16:20:10     [7f89350aa780]  FastqFlowcellInfo(H0P66AGXX,151:151,[3 ])
2014-09-01 16:20:10     [7f89350aa780]  use bases mask: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn,yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn
2014-09-01 16:20:10     [7f89350aa780]  reads parsed: 2
2014-09-01 16:20:10     [7f89350aa780]  Discovered data read: ReadMetadata(1, 150 [1, 150], 0id, 0off,1frc)
2014-09-01 16:20:10     [7f89350aa780]  Discovered data read: ReadMetadata(2, 150 [152, 301], 1id, 150off,152frc)
2014-09-01 16:20:10     [7f89350aa780]  constructed extremity seed SeedMetadata(0, 32, 0, 0)
2014-09-01 16:20:10     [7f89350aa780]  constructed extremity seed SeedMetadata(118, 32, 0, 1)
2014-09-01 16:20:10     [7f89350aa780]  constructed SeedMetadata(32, 32, 0, 2)
2014-09-01 16:20:10     [7f89350aa780]  constructed SeedMetadata(64, 32, 0, 3)
2014-09-01 16:20:10     [7f89350aa780]  constructed extremity seed SeedMetadata(0, 32, 1, 4)
2014-09-01 16:20:10     [7f89350aa780]  constructed extremity seed SeedMetadata(118, 32, 1, 5)
2014-09-01 16:20:10     [7f89350aa780]  constructed SeedMetadata(32, 32, 1, 6)
2014-09-01 16:20:10     [7f89350aa780]  constructed SeedMetadata(64, 32, 1, 7)
2014-09-01 16:20:10     [7f89350aa780]  default-adapters: SequencingAdapterMetadata(AGATCGGAAGAGC,0,0),SequencingAdapterMetadata(GCTCTTCCGATCT,1,0),
2014-09-01 16:20:10     [7f89350aa780]  Generated 'none' barcode: BarcodeMetadata(H0P66AGXX,3,default,none,(0), 4294967295)
2014-09-01 16:20:10     [7f89350aa780]  align: Setting memory limit to 12884901888 bytes.
2014-09-01 16:20:10     [7f89350aa780]  Aligner: adding base-calls path "/path/to/install/Isaac/data_files/PhiX/isaac_test"
2014-09-01 16:20:10     [7f89350aa780]  Determining memory capacity for Fastq data

Here it does not continue. The process is sleeping. strace says:

[...]
write(2, "Determining memory capacity for "..., 42) = 42
write(2, "\n", 1)                       = 1
mmap(NULL, 12884901888, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = -1 ENOMEM (Cannot allocate memory)
brk(0x300cbc000)                        = 0xcb7000
mmap(NULL, 12885037056, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = -1 ENOMEM (Cannot allocate memory)
futex(0x7f89329ea620, FUTEX_WAIT_PRIVATE, 2, NULL) = ? ERESTARTSYS (To be restarted)

This is a 64bit Linux system with 256GB RAM. I started with --memory-limit 128 and finally tried --memory-limit 12 without any effects. ulimit -v is unlimited.

Any idea what is going wrong?

best,
Sven

When we try to compile the ISAAC aligner as per instructed, we've got the following error:
-- Verifying target directories access
-- Check if the system is big endian
-- Searching 16 bit integer
-- Looking for sys/types.h
-- Looking for sys/types.h - found
-- Looking for stdint.h
-- Looking for stdint.h - found
-- Looking for stddef.h
-- Looking for stddef.h - found
-- Check size of unsigned short
-- Check size of unsigned short - done
-- Using unsigned short
-- Check if the system is big endian - little endian
-- inttypes.h found as /usr/include/inttypes.h
-- malloc.h found as /usr/include/malloc.h
-- memory.h found as /usr/include/memory.h
-- signal.h found as /usr/include/signal.h
-- stdint.h found as 1
-- stdlib.h found as /usr/include/stdlib.h
-- string.h found as /usr/include/string.h
-- strings.h found as /usr/include/strings.h
-- time.h found as /usr/include/time.h
CMake Error at cmake/macros.cmake:86 (message):
Required header sys/stat.h not found.
Call Stack (most recent call first):
cmake/cxxConfigure.cmake:43 (isaac_find_header_or_die)
c++/CMakeLists.txt:38 (include)

It seems like for some reason, only the sys/stat.h was not found. Is there anyway to check for that or is there another way round?

Thank you

We are trying to use Isaac and we've managed to install it but we keep getting an error on the indexing step,

The command that was run was,

/gscmnt/sata132/techd/zskidmor/projects/aligner_test/programs/iSSAC-install/bin/isaac-sort-reference -g /gscmnt/sata132/techd/zskidmor/projects/aligner_test/issac_test/all_sequences.fa -o /gscmnt/sata132/techd/zskidmor/projects/aligner_test/issac_test/index_1_op

This job was submitted to a queue using bsub with a high amount of memory available (>100GB), is there any reason why the findNeighbors step would keep crashing? This has occurred more than once.

[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  make Target:    sorted-reference.xml
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  make Reason:    Temp/sorted-reference.xml
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  make Prereqs:   Temp/sorted-reference.xml
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  make Cmd:       /gscmnt/sata132/techd/zskidmor/projects/aligner_test/programs/iSSAC-install/libexec/iSAAC-01.14.03.12/findNeighbors -i Temp/sorted-reference.xml -t Temp/neighbors.dat  --seed-length 32  --output-directory /gscmnt/sata132/techd/zskidmor/projects/aligner_test/issac_test  -o sorted-reference.xml.tmp && mv sorted-reference.xml.tmp sorted-reference.xml
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  2014-03-28 13:25:34     [2b01278e0ac0]  Forcing LC_ALL to C
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  2014-03-28 13:25:34     [2b01278e0ac0]  reserving memory for 5567290342 kmers
[2014-03-28 13:25:34]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  2014-03-28 13:25:34     [2b01278e0ac0]  reserving memory done for 5567290342 kmers
[2014-03-28 13:38:44]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  2014-03-28 13:38:44     [2b01278e0ac0]  loading done for 2552804850 unique forward kmers
[2014-03-28 13:40:27]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  2014-03-28 13:40:26     [2b01278e0ac0]  generating reverse complements done for 2552804850 unique forward kmers
[2014-03-28 13:43:20]   [blade12-1-4.gsc.wustl.edu]     [sorted-reference.xml]  /bin/bash: line 2:  9613 Killed                  /gscmnt/sata132/techd/zskidmor/projects/aligner_test/programs/iSSAC-install/libexec/iSAAC-01.14.03.12/findNeighbors -i Temp/sorted-reference.xml -t Temp/neighbors.dat --seed-length 32 --output-directory /gscmnt/sata132/techd/zskidmor/projects/aligner_test/issac_test -o sorted-reference.xml.tmp

Hi, I'm getting a memory error when running this on a 256GB memory machine with 16 cores. The aligner is ran with 12 threads and 128gb mem as parameters. The error:

2013-09-01 22:47:33     [7f850f23b700]  Saving 2626550564 bytes of sorted data for bin "/runs/run192mem12thread/Temp/bin-00000006-00000025.dat"
2013-09-01 22:47:33     [7f850f23b700]  ERROR: Thread: 18 also caught an exception: /illumina/isaac_aligner-master/src/c++/lib/build/Build.cpp(831): Throw in function void isaac::build::Build::saveBuffer(const std::vector<char>&, std::ostream&, const isaac::bam::BamIndexPart&, isaac::bam::BamIndex&, const boost::filesystem::path&)
Dynamic exception type: boost::exception_detail::clone_impl<isaac::common::IoException>
std::exception::what: Failed to write bgzf block of 2626550564 bytes into bam stream

2013-09-01 22:47:36     [7f8508430700]  WARNING: Holding up processing of bin: "/runs/run192mem12thread/Temp/bin-00000006-00000026.dat" until 17172851258 bytes of allowed memory is available.

Hi,
I'm a new learner about isaac. So, can you help me check whether I use this software correctly?

1. sort for fasta
   ../bin/isaac-sort-reference -g ../test.fasta -j 24 -o ../fasta_sort
   ../bin/isaac-pack-reference -r ../fasta_sort/sorted-reference.xml -j 24
   ../bin/isaac-unpack-reference -i ../packed-reference.tar.gz

2. isaac-align
   ../bin/isaac-align -r ../sorted-reference.xml -b ../test_input/ --base-calls-format fastq -m 50 ...

Q1:
I got a folder containing 'sorted.bam'. When I used samtools to see the align info in 'sorted.bam', it's different from what I saw before, no info about chromosome and so on, so is my result correct?
@hd VN:1.0 SO:coordinate
@pg ID:iSAAC PN:iSAAC CL:/data3/xxw/software/isaac/isaac_01140312/bin/isaac-align -r /data3/xxw/software/isaac/test/sorted-reference.xml -b /data3/xxw/software/isaac/test_input/ --base-calls-format fastq -m 50 --base-quality-cutoff 15 --keep-duplicates yes --variable-read-length yes --realign-gaps no --default-adapters AGATCGGAAGAGC*,*GCTCTTCCGATCT -o /data3/xxw/software/isaac/test_input/out_dir VN:iSAAC-01.14.03.12
@rg ID:0 PL:ILLUMINA SM:default PU:000000000-A8HE7:1:none
@sq SN:chrM LN:16571 UR:/data3/xxw/software/isaac/test/genome.fa M5:d2ed829b8a1628d16cbeee88e88e39eb
@sq SN:chr1 LN:483300 UR:/data3/xxw/software/isaac/test/genome.fa M5:0572953de0e8f244b7ef44f0b058d24c
000000000-A8HE7:1:1:0:0 4 * 0 0 * * 0 0 ACGCTGTTGGCCTGGATCTGAGCCCTGGTGTTCTGCCATTGCTGCTGTGTGGAAGTTCACAGAGCCTCCACCACCCCGAGATCACATTT AAA?11DFF11@1FEGGC0FDFHFF0B1D11>AAACB1B@133BA33AB1BEHHAFFHHG>1>1>CF1?1ADGGGF0EEEGGHHGCEHF RG:Z:0 NM:i:0 BC:Z:none

Q2. Has the "sorted.bam" file been sorted by coordinate based on isaac?
If so, there is no need for me to sort again by samtools or picard.

I'm looking forward to your reply!
Thanks very much from my heart!

Hello,
When compiling the latest release (using gcc 4.6.4), I'm getting the following error:

[ 57%] Building CXX object c++/lib/alignment/CMakeFiles/isaac_alignment.dir/MatchFinder.cpp.o
In file included from /home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter.hpp:14:0,
from /home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/cast.hpp:33,
from /home/isaac_aligner/src/bootstrap/include/boost/lexical_cast.hpp:66,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/string_parse_tree.hpp:13,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/period_parser.hpp:14,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/date_facet.hpp:23,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/gregorian/gregorian_io.hpp:16,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/gregorian/gregorian.hpp:31,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/posix_time/time_formatters.hpp:12,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/posix_time/posix_time.hpp:24,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time/local_time/local_time.hpp:11,
from /home/isaac_aligner/src/bootstrap/include/boost/date_time.hpp:15,
from /home/isaac_aligner/src/c++/include/common/Debug.hh:27,
from /home/isaac_aligner/src/c++/include/alignment/SeedMetadata.hh:32,
from /home/isaac_aligner/src/c++/include/alignment/MatchFinder.hh:35,
from /home/isaac_aligner/src/c++/lib/alignment/MatchFinder.cpp:38:
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter_policies.hpp: In static member function ‘static boost::numeric::Trunc::source_type boost::numeric::Trunc::nearbyint(boost::numeric::Trunc::argument_type) [with S = __int128 unsigned, boost::numeric::Trunc::source_type = __int128 unsigned, boost::numeric::Trunc::argument_type = const __int128 unsigned&]’:
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/detail/converter.hpp:494:57: instantiated from ‘static boost::numeric::convdetail::rounding_converter<Traits, RangeChecker, RawConverter, Float2IntRounder>::result_type boost::numeric::convdetail::rounding_converter<Traits, RangeChecker, RawConverter, Float2IntRounder>::convert(boost::numeric::convdetail::rounding_converter<Traits, RangeChecker, RawConverter, Float2IntRounder>::argument_type) [with Traits = boost::numeric::conversion_traits<int, __int128 unsigned>, RangeChecker = boost::numeric::convdetail::dummy_range_checker<boost::numeric::conversion_traits<int, __int128 unsigned> >, RawConverter = boost::numeric::raw_converter<boost::numeric::conversion_traits<int, __int128 unsigned> >, Float2IntRounder = boost::numeric::Trunc<__int128 unsigned>, boost::numeric::convdetail::rounding_converter<Traits, RangeChecker, RawConverter, Float2IntRounder>::result_type = int, boost::numeric::convdetail::rounding_converter<Traits, RangeChecker, RawConverter, Float2IntRounder>::argument_type = const __int128 unsigned&]’
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/cast.hpp:53:38: instantiated from ‘Target boost::numeric_cast(Source) [with Target = int, Source = __int128 unsigned]’
/home/isaac_aligner/src/c++/lib/alignment/MatchFinder.cpp:236:9: instantiated from ‘std::pair<typename std::vector<isaac::alignment::Seed >::const_iterator, typename std::vectorisaac::alignment::Seed::const_iterator> isaac::alignment::MatchFinder::skipToTheNextMask(typename std::vectorisaac::alignment::Seed::const_iterator, typename std::vectorisaac::alignment::Seed::const_iterator, KmerT, unsigned int, bool) [with KmerT = __int128 unsigned, typename std::vectorisaac::alignment::Seed::const_iterator = __gnu_cxx::__normal_iterator<const isaac::alignment::Seed<__int128 unsigned>, std::vector<isaac::alignment::Seed<__int128 unsigned>, std::allocator<isaac::alignment::Seed<__int128 unsigned> > > >]’
/home/isaac_aligner/src/c++/lib/alignment/MatchFinder.cpp:323:16: instantiated from here
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter_policies.hpp:41:53: error: call of overloaded ‘floor(const __int128 unsigned&)’ is ambiguous
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter_policies.hpp:41:53: note: candidates are:
/usr/include/bits/mathcalls.h:185:1: note: double floor(double)
/home/gcc-4.6.4/lib/gcc/x86_64-unknown-linux-gnu/4.6.4/../../../../include/c++/4.6.4/cmath:249:3: note: float std::floor(float)
/home/gcc-4.6.4/lib/gcc/x86_64-unknown-linux-gnu/4.6.4/../../../../include/c++/4.6.4/cmath:253:3: note: long double std::floor(long double)
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter_policies.hpp:41:53: error: call of overloaded ‘ceil(const __int128 unsigned&)’ is ambiguous
/home/isaac_aligner/src/bootstrap/include/boost/numeric/conversion/converter_policies.hpp:41:53: note: candidates are:
/usr/include/bits/mathcalls.h:179:1: note: double ceil(double)
/home/gcc-4.6.4/lib/gcc/x86_64-unknown-linux-gnu/4.6.4/../../../../include/c++/4.6.4/cmath:169:3: note: float std::ceil(float)
/home/gcc-4.6.4/lib/gcc/x86_64-unknown-linux-gnu/4.6.4/../../../../include/c++/4.6.4/cmath:173:3: note: long double std::ceil(long double)
make[2]: ** [c++/lib/alignment/CMakeFiles/isaac_alignment.dir/MatchFinder.cpp.o] Error 1
make[1]: *** [c++/lib/alignment/CMakeFiles/isaac_alignment.dir/all] Error 2
make: *** [all] Error 2

Building iSAAC aligner triggers a known compiler error in GCC 4.8 (bug 57655):

[ 27%] Building CXX object c++/lib/demultiplexing/CMakeFiles/isaac_demultiplexing.dir/BarcodeResolver.cpp.o /projects/hli-group/apps/src/isaac_aligner-iSAAC-01.14.04.01/src/c++/lib/demultiplexing/BarcodeResolver.cpp: In static member function ‘static std::pair<long unsigned int, unsigned int> isaac::demultiplexing::BarcodeResolver::get2MismatchKmer(isaac::demultiplexing::Kmer, unsigned int, unsigned int, unsigned int)’: /projects/hli-group/apps/src/isaac_aligner-iSAAC-01.14.04.01/src/c++/lib/demultiplexing/BarcodeResolver.cpp:137:1: internal compiler error: in create_pre_exit, at mode-switching.c:418 } ^ Please submit a full bug report, with preprocessed source if appropriate. See <http://gcc.gnu.org/bugs.html> for instructions. make[2]: *** [c++/lib/demultiplexing/CMakeFiles/isaac_demultiplexing.dir/BarcodeResolver.cpp.o] Error 1 make[1]: *** [c++/lib/demultiplexing/CMakeFiles/isaac_demultiplexing.dir/all] Error 2 make: *** [all] Error 2

I realize this is a GCC problem and not an iSAAC problem, but a workaround on the iSAAC side would be great so that it can be built with gcc > 4.7.

Hi,

I was confused about which license applied to this package. The README says BSD-2, but the PDF file in the distribution says Illumina Open Source. It looks like the README file was changed recently to remove the reference to the Illumina license. Can you clarify please?

Thanks

David

I run isaac_aligner followed by isaac_variantcaller on four different synthetic datasets of WGS
at 50X coverage and different error rates: 0.1 0.01 0.04 0.05
paired reads, 100bp read length.

For each dataset of reads we also generated a 'golden.vcf' to compare results against and obtain
concordance statistics.

Each golden.vcf file had [960k-970k] snps and [40k-50k] indels

Our concordance numbers look like this:

                                       in both              in golden.vcf               in isaac.vcf

error rate 0.01: 72118 894849 253399316
error rate 0.04: 19670 948909 539832262
error rate 0.05: 19670 948909 539832262
error rate 0.1: 62 960334 2334643

Can you recommend some fine-tuning options for me to try in order to improve
these numbers?

Thanks

These are the details of my runs

The compute nodes I run these jobs in vary in terms of hardware configurations.
RAM 64gb, 128gb, 256gb... The number of cores per node was at least 24

I did not make changes to the init/config files.

The command line for isaac_aligner looks similar to this one in all four cases.
(this one came directly from the sorted.bam generated by isaac_aligner)
As you can see, I just specified memory and number of threads in the param line.

@pg ID:iSAAC PN:iSAAC CL:/ui/mayo/rendong/bin/isaac_aligner/bin/isaac-align -r /scratch/users/rendong/humangenome/isaac_index/sorted-reference.xml -m 90 -b /ui/mayo/rendong/scratch-global/humanReads/WholeGenome_50X_100nt_0.01ErrorRate --base-calls-format fastq -j 20 --variable-read-length yes VN:iSAAC-01.14.04.17

The command line for isaac_variantcaller looks similar to this one in all four cases.
In this case, I extracted this line from the sorted.genome.vcf.gz file generated by
isaac_variantcaller

cmdline=/ui/mayo/rendong/bin/isaac_variantcaller/libexec/starling2 --gvcf-file

• --gvcf-max-depth-factor 3.0 --gvcf-min-gqx 30 --gvcf-max-indel-ref-repeat -1
  -bam-file /scratch/users/rendong/isaac_test/isaac_align_WholeGenome_50X_100nt_0.
  01ErrorRate_th20_mem90gb_bigmem/Aligned/Projects/default/default/sorted.bam -sam
  tools-reference /scratch/users/rendong/humangenome/genome.fa -bam-seq-name chrM
  -report-range-begin 1 -report-range-end 25000000 -clobber -min-paired-align-scor
  e 20 -min-single-align-score 20 -bsnp-ssd-no-mismatch 0.35 -bsnp-ssd-one-mismatc
  h 0.6 -min-vexp 0.25 -max-window-mismatch 2 20 -max-indel-size 50 -genome-size 2
  861343702 --max-input-depth 10000 --chrom-depth-file /scratch/users/rendong/isaa
  c_test/isaac_vcall_WholeGenome_50X_100nt_0.01ErrorRate_th20_mem90gb_bigmem/confi
  g/chrom.depth.txt

Please don't use the term "open source" as your license is neither OSI approved nor likely to be accepted by OSI if submitted for approval.

Newer versions of the c++ compilers (those which are standard in ubuntu 13) don't play nicely with the TIME_UTC variable defined in boost_1_49_0. This is fixed in a later version, but attempting to build iSAAC on a fresh checkout results in boost failing to install with

./boost/thread/xtime.hpp:88:1: error: expected declaration before ‘}’ token

the (ugly) hack of

• downloading boost_1_55_0
• unpacking and renaming directory to boost_1_49_0
• repacking and replacing the boost_1_49_0.tar.bz2 that comes with iSAAC

results in a happy build.

Currently running the configure command always fails the first time. The error is similar to as follows:

/home/vagrant/isaac_rebuild/bootstrap/bin/cmake -H"/home/vagrant/isaac_aligner/src" -B"/home/vagrant/isaac_rebuild" -G"Unix Makefiles"  -DiSAAC_PREFIX:STRING=/home/vagrant/isaac_rebuild/ -DiSAAC_EXEC_PREFIX:STRING= -DiSAAC_BINDIR:PATH= -DiSAAC_LIBDIR:PATH= -DiSAAC_LIBEXECDIR:PATH= -DiSAAC_INCLUDEDIR:PATH= -DiSAAC_DATADIR:PATH= -DiSAAC_DOCDIR:PATH= -DiSAAC_MANDIR:PATH= -DCMAKE_BUILD_TYPE:STRING=RelWithDebInfo -DCMAKE_PARALLEL:INTEGER=1 -DiSAAC_ALLOW_NUMA:BOOL=ON

Moving CMakeCache.txt to CMakeCache.txt.removed

I assume this is because cmake cannot find the newly minted boost libraries that are built before the following error messages:

CMake Error at /home/vagrant/isaac_rebuild/bootstrap/share/cmake-2.8/Modules/FindBoost.cmake:1191 (message):
  Unable to find the requested Boost libraries.

  Boost version: 1.53.0

  Boost include path: /home/vagrant/isaac_rebuild/bootstrap/include

  The following Boost libraries could not be found:

          boost_date_time
          boost_filesystem
          boost_iostreams
          boost_program_options
          boost_regex
          boost_serialization
          boost_system
          boost_thread

  No Boost libraries were found.  You may need to set BOOST_LIBRARYDIR to the
  directory containing Boost libraries or BOOST_ROOT to the location of
  Boost.
Call Stack (most recent call first):
  cmake/boost.cmake:92 (find_package)
  cmake/cxxConfigure.cmake:88 (isaac_find_boost)
  c++/CMakeLists.txt:38 (include)

Running the configure command again after it fails allows configuration to proceed successfully. For your reference my command was as suggested in the install ../isaac_aligner/src/configure --prefix=/home/vagrant/isaac_rebuild

Hi,

assuming the following use case:

Three lanes from three different runs, all with the same library:

run1_L1_Lib1_Read1
run1_L1_Lib1_Read2

run2_L1_Lib1_Read1
run2_L1_Lib1_Read2

run3_L1_Lib1_Read1
run3_L1_Lib1_Read2

All libs are supplied as demultiplexed fastq files.

I'd like to align all fastq files together, but I am very limited in file naming ...

I could, in this case, rename the fastqs like:

lane1_read1.fastq.gz
lane1_read2.fastq.gz

lane2_read1.fastq.gz
lane2_read2.fastq.gz

lane3_read1.fastq.gz
lane3_read2.fastq.gz

.. where lane==run, which is very ugly and eliminates the real lane info.
Even worse when trying to align 10 lanes from different runs.

How do you deal with that in practice?
Why is file naming so restricted?

best,
Sven

I run isaac_aligner on a WGS synthetic dataset at 50X coverage and 0.01 error rate.

When I tried to then examine the sorted.bam file produced by the aligner
and checked where the reads were mapped to, I found out that all the reads
have been renamed in the sorted.bam file.

Is there a parameter I need to specify to indicate that I want the reads not to
be renamed by the aligner? OR is there a utility/script that I can use to
run on the bam file to restore those read names?

Thanks in advance

This is how my raw reads look like

@chrM-11881-12069-6012/1
ACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTCCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATA
CTAGTCACAGCCCTATACTC
+

;?AAAA:C5>97=;<;7=>7)EA9=;;<>769:>$@?::8=;4>79=A>>63=>;9:>;>9=;==??=<9;4:>9???
=?????>004>;>;?=>7;=
@chrM-11902-12079-6014/1
TGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCTACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCC
CTCTACATATTTACCACAAC
+
;>068AA53=9?A::?=>;>6=;@;<>9;54<:=;;>9=A:@?=A?AA?A???9:?@;?A?604<< @???>63??@:???7;;>:>
@chrM-11944-12169-6016/1
TTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAACACAATGGGGCTCACTCACCCAC
CACATTAACAACATAAAACC
+
;>AAAAA.??A<=72<>3><.E>-EB>47:;:<>7;783:>:AA=8<;:>108<=9:>;>;>>6;?>666=??A<>=??
??@5>7;005>903>7=?

These are the top 30 lines of the sorted.bam file produced by isaac_aligner

@hd VN:1.0 SO:coordinate
@pg ID:iSAAC PN:iSAAC CL:/ui/mayo/rendong/bin/isaac_aligner/bin/isaac-align -r /scratch/users/rendong/humangenome/isaac_index/sorted-reference.xml -m 90 -b /ui/mayo/rendong/scratch-global/humanReads/WholeGenome_50X_100nt_0.01ErrorRate --base-calls-format fastq -j 20 --variable-read-length yes VN:iSAAC-01.14.04.17
@rg ID:0 PL:ILLUMINA SM:default PU:unknown-flowcell:1:none
@sq SN:chrM LN:16571 UR:/scratch/users/rendong/humangenome/genome.fa M5:d2ed829b8a1628d16cbeee88e88e39eb
@sq SN:chr1 LN:249250621 UR:/scratch/users/rendong/humangenome/genome.fa M5:1b22b98cdeb4a9304cb5d48026a85128
@sq SN:chr2 LN:243199373 UR:/scratch/users/rendong/humangenome/genome.fa M5:a0d9851da00400dec1098a9255ac712e
@sq SN:chr3 LN:198022430 UR:/scratch/users/rendong/humangenome/genome.fa M5:641e4338fa8d52a5b781bd2a2c08d3c3
@sq SN:chr4 LN:191154276 UR:/scratch/users/rendong/humangenome/genome.fa M5:23dccd106897542ad87d2765d28a19a1
@sq SN:chr5 LN:180915260 UR:/scratch/users/rendong/humangenome/genome.fa M5:0740173db9ffd264d728f32784845cd7
@sq SN:chr6 LN:171115067 UR:/scratch/users/rendong/humangenome/genome.fa M5:1d3a93a248d92a729ee764823acbbc6b
@sq SN:chr7 LN:159138663 UR:/scratch/users/rendong/humangenome/genome.fa M5:618366e953d6aaad97dbe4777c29375e
@sq SN:chr8 LN:146364022 UR:/scratch/users/rendong/humangenome/genome.fa M5:96f514a9929e410c6651697bded59aec
@sq SN:chr9 LN:141213431 UR:/scratch/users/rendong/humangenome/genome.fa M5:3e273117f15e0a400f01055d9f393768
@sq SN:chr10 LN:135534747 UR:/scratch/users/rendong/humangenome/genome.fa M5:988c28e000e84c26d552359af1ea2e1d
@sq SN:chr11 LN:135006516 UR:/scratch/users/rendong/humangenome/genome.fa M5:98c59049a2df285c76ffb1c6db8f8b96
@sq SN:chr12 LN:133851895 UR:/scratch/users/rendong/humangenome/genome.fa M5:51851ac0e1a115847ad36449b0015864
@sq SN:chr13 LN:115169878 UR:/scratch/users/rendong/humangenome/genome.fa M5:283f8d7892baa81b510a015719ca7b0b
@sq SN:chr14 LN:107349540 UR:/scratch/users/rendong/humangenome/genome.fa M5:98f3cae32b2a2e9524bc19813927542e
@sq SN:chr15 LN:102531392 UR:/scratch/users/rendong/humangenome/genome.fa M5:e5645a794a8238215b2cd77acb95a078
@sq SN:chr16 LN:90354753 UR:/scratch/users/rendong/humangenome/genome.fa M5:fc9b1a7b42b97a864f56b348b06095e6
@sq SN:chr17 LN:81195210 UR:/scratch/users/rendong/humangenome/genome.fa M5:351f64d4f4f9ddd45b35336ad97aa6de
@sq SN:chr18 LN:78077248 UR:/scratch/users/rendong/humangenome/genome.fa M5:b15d4b2d29dde9d3e4f93d1d0f2cbc9c
@sq SN:chr19 LN:59128983 UR:/scratch/users/rendong/humangenome/genome.fa M5:1aacd71f30db8e561810913e0b72636d
@sq SN:chr20 LN:63025520 UR:/scratch/users/rendong/humangenome/genome.fa M5:0dec9660ec1efaaf33281c0d5ea2560f
@sq SN:chr21 LN:48129895 UR:/scratch/users/rendong/humangenome/genome.fa M5:2979a6085bfe28e3ad6f552f361ed74d
@sq SN:chr22 LN:51304566 UR:/scratch/users/rendong/humangenome/genome.fa M5:a718acaa6135fdca8357d5bfe94211dd
@sq SN:chrX LN:155270560 UR:/scratch/users/rendong/humangenome/genome.fa M5:7e0e2e580297b7764e31dbc80c2540dd
@sq SN:chrY LN:59373566 UR:/scratch/users/rendong/humangenome/genome.fa M5:1e86411d73e6f00a10590f976be01623
unknown-flowcell:1:54:1183413:0 99 chrM 1 0 99M = 192 287 GATCACAGGTCTATCACCCTATTAACCACTCACGGGCGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCT >>;?AAAA:C5>97=;<;7=>7)EA9=;;<>769:>$@?::8=;4>79=A>>63=>;9:>;>9=;==??=<9;4:>9???=?????>004>;>;?=>7; RG:Z:0 NM:i:1 BC:Z:none
unknown-flowcell:1:54:1183434:0 99 chrM 8 0 99M = 207 297 GGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGAACGCGATAGCATTGCGAGACGCTGGAGCCG >;>:AAAAA<?;<A<9=::;<4>:,,/35D=:@aa;>8>7;>:>9;7:69;A>668:@;6(EA?;;;:>;><>9?;=>9:>;>:>95>9:>79=>:?;> RG:Z:0 NM:i:1 BC:Z:none

Hello,
I am using isaac alighner command as follows and it is working fine with 1TB RAM system. When I am trying the same command in 128 GB RAM system the system is giving error. Even I have reduced the memory with -m option, still getting the same issue. The command is as follows

$ /opt/illumina/Isaac/Isaac-00.13.02.01/bin/isaac-align -r /home/softwarelibrary/hg19_isacRef/Homo_sapiens/UCSC/hg19/Sequence/IsaacIndex/sorted-reference.xml -b ../Sample_1/ --base-calls-format fastq-gz --default-adapters AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT_,_CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT --base-quality-cutoff 20 --variable-fastq-read-length 1 --ignore-neighbors 1 --ignore-missing-bcls 1 --ignore-missing-filters 1 --memory-limit 64

The error I am getting is

2016-09-07 11:17:14 [0x1e92c30] ERROR: **** Internal Program Error - assertion (!compressedStream.good()) failed in std::streamsize isaac::io::InflateGzipDecompressor::read(std::istream&, char, std::streamsize) [with ContainterT = isaac::common::FiniteCapacityVector<char, 4096ul>; std::streamsize = long int; std::istream = std::basic_istream]:/export/scratch/rpetrovski/workspace2/iSAAC/src/c++/include/io/InflateGzipDecompressor.hh(181): When no bytes come out of decompressor expecting the input stream to be over
Segmentation fault (core dumped)

Please help to sort the issue

2020-04-07 13:36:47 [7f9c73d0a7c0] Forcing LC_ALL to C
2020-04-07 13:36:47 [7f9c73d0a7c0] Version: iSAAC-01.15.04.01
2020-04-07 13:36:47 [7f9c73d0a7c0] argc: 9 argv: isaac-align -r isaac_aligner/hs37d5.fa -b Fastq -m 40 --base-calls-format fastq-gz
2020-04-07 13:36:47 [7f9c73d0a7c0] Opened fastq stream on isaac_aligner/Fastq/lane1_read1.fastq.gz
2020-04-07 13:36:47 [7f9c73d0a7c0] Opened fastq stream on isaac_aligner/Fastq/lane1_read2.fastq.gz
2020-04-07 13:36:47 [7f9c73d0a7c0] FastqFlowcellInfo(1,76:76,[1 ])
2020-04-07 13:36:47 [7f9c73d0a7c0] use bases mask: yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn,yyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyyn
2020-04-07 13:36:47 [7f9c73d0a7c0] reads parsed: 2
2020-04-07 13:36:47 [7f9c73d0a7c0] Discovered data read: ReadMetadata(1, 75 [1, 75], 0id, 0off,1frc)
2020-04-07 13:36:47 [7f9c73d0a7c0] Discovered data read: ReadMetadata(2, 75 [77, 151], 1id, 75off,77frc)
2020-04-07 13:36:47 [7f9c73d0a7c0] constructed extremity seed SeedMetadata(0, 32, 0, 0)
2020-04-07 13:36:47 [7f9c73d0a7c0] constructed extremity seed SeedMetadata(43, 32, 0, 1)
2020-04-07 13:36:47 [7f9c73d0a7c0] constructed extremity seed SeedMetadata(0, 32, 1, 2)
2020-04-07 13:36:47 [7f9c73d0a7c0] constructed extremity seed SeedMetadata(43, 32, 1, 3)
2020-04-07 13:36:47 [7f9c73d0a7c0] Generated 'none' barcode: BarcodeMetadata(1,1,default,none,(0), 4294967295)
2020-04-07 13:36:47 [7f9c73d0a7c0] align: Setting memory limit to 42949672960 bytes.
:1: parser error : Document is empty

chr1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
^
Error: 2020-Apr-07 13:36:47: Success: /root/isaac_aligner/src/c++/lib/xml/XmlReader.cpp(330): Throw in function bool isaac::xml::XmlReader::read()
Dynamic exception type: boost::exception_detail::clone_implisaac::xml::XmlReaderException
std::exception::what: xmlTextReaderRead failed
: xmlTextReaderRead failed

The reference genome TAIR10 for arabidopsis thaliana. Size 119481543
The Sakata reads files come from this url
http://1001genomes.org/data/JGI/JGIHeazlewood2011/releases/current/TAIR10/strains/

PE reads 60173258

read length 100
avg depth 36.87
std depth 313.73

Several benchmarking jobs were submitted to an SGI UV1000 node with 384 Intel Xeon X7542 and 2TB of memory.
I assigned 150gb of memory to each job.
Number of cores assigned to each job varied = 36, 24, 16, 8
All but one job finished successfully. The job with 36 cores failed. Below are the last few lines of the error log.

2014-07-25 14:56:11 [2b53393de700] Opened fastq stream on /home/a-m/gren
don/tair-isaac-pipeline_test/index/sakata_reads/lane1_read1.fastq
2014-07-25 14:56:11 [2b53393de700] Opened fastq stream on /home/a-m/gren
don/tair-isaac-pipeline_test/index/sakata_reads/lane1_read2.fastq
2014-07-25 14:56:11 [2b53393de700] Resetting Fastq data for 5000000 clus
ters
2014-07-25 14:56:13 [2b53393de700] Resetting Fastq data done for 5000000
clusters
2014-07-25 14:56:54 [2b53393de700] Loading Fastq data done. Loaded 50000
00 clusters for TileMetadata(1101, 1, 1, 5000000, 0)
2014-07-25 14:56:54 [2b53393de700] Sorting matches by barcode for TileMe
tadata(1101, 1, 1, 5000000, 0)
2014-07-25 14:56:54 [2b53391dd700] Loading matches for TileMetadata(1101
, 2, 1, 5000000, 1)

libgomp: Thread creation failed: Resource temporarily unavailable

I was doing an aligning an exome data with the following command.

$ /home/shamsion/softwarelibrary/isaac2-master/build/bin/isaac-align -r /home/shamsion/softwarelibrary/FormatVersion6_iSAAC-02_15_07_25690771/sorted-reference.xml -b ../Rao_P2RX7_Family/ --base-calls-format fastq-gz --base-quality-cutoff 20 -m 120 -j 32 -o H10_alighned --realign-vigorously yes

The command exit with an error
2016-09-12 21:26:48 [7fc0444bb700] ERROR: ***** Internal Program Error - assertion (undoneAlignmentPos <= long(undoPivotGap.getEndPos(false).getPosition())) failed in isaac::build::GapRealigner::GapChoice isaac::build::GapRealigner::findBetterGapsChoice(const isaac::build::gapRealigner::GapsRange&, const isaac::reference::ReferencePosition&, const isaac::reference::ReferencePosition&, const std::vectorisaac::reference::Contig&, const isaac::io::FragmentAccessor&, const isaac::build::PackedFragmentBuffer::Index&, unsigned int&):/home/shamsion/softwarelibrary/isaac2-master/src/c++/lib/build/GapRealigner.cpp(1089): undoPivotPos pos ReferencePosition(0:3212350:0f) overlapped by an existing deletion PackedFragmentBuffer::Index(ReferencePosition(0:3212350:0f),64583823do 64583562mdo, 48M2510D52M)
Segmentation fault (core dumped)

Where as when i run with only by using --realign-gaps yes instead of --realign-vigorously yes, it is working fine. Why this core dump error is coming?
If I want to use both the option what is the preferable commandline/input

Thanks
Shams

I am reading a paper which references iSAAc version 1.14.02.06. However, I don't see this version here. Is that a misprint, or are there other versions published elsewhere? Thanks!